Incidental Mutation 'R6386:Wdr25'
ID515612
Institutional Source Beutler Lab
Gene Symbol Wdr25
Ensembl Gene ENSMUSG00000040877
Gene NameWD repeat domain 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location108893631-109028452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109025065 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000152632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047115] [ENSMUST00000167816] [ENSMUST00000221510]
Predicted Effect probably damaging
Transcript: ENSMUST00000047115
AA Change: S393P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035553
Gene: ENSMUSG00000040877
AA Change: S393P

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167816
AA Change: S393P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129855
Gene: ENSMUSG00000040877
AA Change: S393P

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221510
AA Change: S41P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7646 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Wdr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Wdr25 APN 12 109025027 missense possibly damaging 0.89
IGL02479:Wdr25 APN 12 108898601 missense probably benign
IGL02672:Wdr25 APN 12 108898081 nonsense probably null
IGL03329:Wdr25 APN 12 108898336 missense probably benign
R1061:Wdr25 UTSW 12 108992799 splice site probably null
R1402:Wdr25 UTSW 12 109026539 missense probably damaging 1.00
R1402:Wdr25 UTSW 12 109026539 missense probably damaging 1.00
R1582:Wdr25 UTSW 12 108898054 missense possibly damaging 0.94
R1764:Wdr25 UTSW 12 109026438 nonsense probably null
R1954:Wdr25 UTSW 12 108898541 missense probably damaging 0.99
R2258:Wdr25 UTSW 12 108898174 missense possibly damaging 0.94
R3770:Wdr25 UTSW 12 108898420 missense probably damaging 0.97
R3803:Wdr25 UTSW 12 108898553 missense probably damaging 1.00
R3948:Wdr25 UTSW 12 109027282 missense probably benign 0.02
R4183:Wdr25 UTSW 12 109027331 missense probably benign 0.00
R5246:Wdr25 UTSW 12 109027456 missense probably benign 0.06
R5290:Wdr25 UTSW 12 108898042 missense probably benign 0.26
R5305:Wdr25 UTSW 12 109026440 missense probably damaging 1.00
R5813:Wdr25 UTSW 12 109027421 missense possibly damaging 0.47
R5942:Wdr25 UTSW 12 108898466 missense probably benign 0.00
R7171:Wdr25 UTSW 12 109024996 missense probably damaging 0.98
R7449:Wdr25 UTSW 12 109026441 missense probably damaging 1.00
R7616:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7617:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7619:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7622:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7623:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAGTACTACCTAACACTCCTTGGC -3'
(R):5'- ACCTGACCTATGACTACCCCTG -3'

Sequencing Primer
(F):5'- CTTTCCCTGGGTGAGCAC -3'
(R):5'- ATGACTACCCCTGTCCTAGATAC -3'
Posted On2018-05-04