Incidental Mutation 'R6386:Zfp874b'
ID515614
Institutional Source Beutler Lab
Gene Symbol Zfp874b
Ensembl Gene ENSMUSG00000059839
Gene Namezinc finger protein 874b
Synonyms9630025I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67471513-67484258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67474843 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 116 (D116G)
Ref Sequence ENSEMBL: ENSMUSP00000153242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019572] [ENSMUST00000223868]
Predicted Effect probably benign
Transcript: ENSMUST00000019572
AA Change: D112G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019572
Gene: ENSMUSG00000059839
AA Change: D112G

DomainStartEndE-ValueType
KRAB 5 65 4.48e-26 SMART
ZnF_C2H2 136 158 5.9e-3 SMART
ZnF_C2H2 164 186 3.16e-3 SMART
ZnF_C2H2 192 214 6.78e-3 SMART
ZnF_C2H2 220 242 2.4e-3 SMART
ZnF_C2H2 248 268 1.88e2 SMART
ZnF_C2H2 276 298 6.42e-4 SMART
ZnF_C2H2 304 326 2.12e-4 SMART
ZnF_C2H2 332 354 1.28e-3 SMART
ZnF_C2H2 360 382 8.47e-4 SMART
ZnF_C2H2 388 410 1.79e-2 SMART
ZnF_C2H2 416 438 1.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223711
Predicted Effect possibly damaging
Transcript: ENSMUST00000223868
AA Change: D116G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225027
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Other mutations in Zfp874b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Zfp874b APN 13 67474016 missense probably damaging 1.00
R0432:Zfp874b UTSW 13 67481836 missense probably damaging 1.00
R0653:Zfp874b UTSW 13 67474933 missense possibly damaging 0.69
R0727:Zfp874b UTSW 13 67474712 missense probably damaging 1.00
R1475:Zfp874b UTSW 13 67474092 unclassified probably null
R1726:Zfp874b UTSW 13 67474720 missense probably damaging 1.00
R5484:Zfp874b UTSW 13 67481254 missense possibly damaging 0.76
R7029:Zfp874b UTSW 13 67474273 missense probably damaging 0.98
R7150:Zfp874b UTSW 13 67474503 nonsense probably null
R7726:Zfp874b UTSW 13 67473856 missense probably benign 0.01
R7778:Zfp874b UTSW 13 67473974 missense probably benign 0.03
R7824:Zfp874b UTSW 13 67473974 missense probably benign 0.03
R8053:Zfp874b UTSW 13 67474098 missense probably damaging 0.96
X0028:Zfp874b UTSW 13 67474060 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTTATGCTGGTTAAGAAAGAAAGC -3'
(R):5'- ACTAGAAGGATAGATCAGATCAGCTAC -3'

Sequencing Primer
(F):5'- GAAGAAAGGCTTTGTCACACTC -3'
(R):5'- CTTGCTCAACAGGAACAAC -3'
Posted On2018-05-04