Incidental Mutation 'R6386:Rps24'
ID515616
Institutional Source Beutler Lab
Gene Symbol Rps24
Ensembl Gene ENSMUSG00000025290
Gene Nameribosomal protein S24
SynonymsMRP S24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R6386 (G1)
Quality Score207.009
Status Not validated
Chromosome14
Chromosomal Location24487125-24496959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24492048 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 71 (G71S)
Ref Sequence ENSEMBL: ENSMUSP00000152944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223999] [ENSMUST00000224568] [ENSMUST00000225023]
Predicted Effect probably benign
Transcript: ENSMUST00000026322
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112384
AA Change: G71S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290
AA Change: G71S

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 23 108 4.4e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169826
AA Change: G71S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290
AA Change: G71S

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 24 102 1.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223939
Predicted Effect possibly damaging
Transcript: ENSMUST00000223999
AA Change: G71S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224549
Predicted Effect possibly damaging
Transcript: ENSMUST00000224568
AA Change: G59S

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225014
Predicted Effect possibly damaging
Transcript: ENSMUST00000225023
AA Change: G71S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225994
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Rps24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Rps24 APN 14 24491755 missense probably benign
R1209:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1317:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1363:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1365:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1393:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1427:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1429:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1771:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1776:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R2916:Rps24 UTSW 14 24491941 missense probably benign 0.02
R4837:Rps24 UTSW 14 24491787 missense possibly damaging 0.93
R6146:Rps24 UTSW 14 24490735 start gained probably null
R6249:Rps24 UTSW 14 24493462 missense possibly damaging 0.92
R7316:Rps24 UTSW 14 24490689 unclassified probably benign
V7732:Rps24 UTSW 14 24491762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCAGAGTCAAAATGTGGTC -3'
(R):5'- GAACACCACAAGTTTGGCCC -3'

Sequencing Primer
(F):5'- ATCAGAGTCAAAATGTGGTCTTTGTG -3'
(R):5'- GGCCCAAACTGCTTATTGTATC -3'
Posted On2018-05-04