Mutagenetix > Incidental Mutation

Incidental Mutation 'R6386:Rps24'

515616

Institutional Source

Beutler Lab

Gene Symbol

Rps24

Ensembl Gene

ENSMUSG00000025290

Gene Name

ribosomal protein S24

Synonyms

MRP S24

MMRRC Submission

044535-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.826) question?

Stock #

R6386 (G1)

Quality Score

207.009

Status

Not validated

Chromosome

Chromosomal Location

24540746-24547028 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24542116 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 71 (G71S)

Ref Sequence

ENSEMBL: ENSMUSP00000152944 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223999] [ENSMUST00000224568] [ENSMUST00000225023]

AlphaFold

P62849

Predicted Effect

probably benign
Transcript: ENSMUST00000026322

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112384
AA Change: G71S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290
AA Change: G71S

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S24e	23	108	4.4e-41	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169826
AA Change: G71S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290
AA Change: G71S

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S24e	24	102	1.9e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223939

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223999
AA Change: G71S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224549

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224568
AA Change: G59S

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225023
AA Change: G71S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224699

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224569

Meta Mutation Damage Score

0.7630

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak6	TGACGA	TGA	13: 100,792,311 (GRCm39)		probably benign	Het
Arap2	A	T	5: 62,761,865 (GRCm39)	N1620K	possibly damaging	Het
Atf6b	T	C	17: 34,870,825 (GRCm39)	S396P	probably damaging	Het
Cc2d1a	A	G	8: 84,865,166 (GRCm39)	M469T	probably damaging	Het
Ceacam3	A	G	7: 16,892,144 (GRCm39)	N296D	probably benign	Het
Cep57l1	A	T	10: 41,619,128 (GRCm39)	S80T	probably damaging	Het
Clip4	C	A	17: 72,141,189 (GRCm39)	Y514*	probably null	Het
Cop1	T	C	1: 159,116,601 (GRCm39)	I125T	probably damaging	Het
Cstf1	T	C	2: 172,219,816 (GRCm39)	V309A	probably damaging	Het
Cyp4a29	T	G	4: 115,104,272 (GRCm39)		probably null	Het
F830045P16Rik	G	A	2: 129,314,738 (GRCm39)	H180Y	probably damaging	Het
Foxp4	T	C	17: 48,189,387 (GRCm39)	K237E	unknown	Het
Fstl5	A	T	3: 76,229,373 (GRCm39)	H58L	probably benign	Het
Gje1	A	G	10: 14,592,365 (GRCm39)	F139S	probably damaging	Het
Gpatch1	T	C	7: 34,991,265 (GRCm39)	D593G	probably damaging	Het
Inpp5d	T	A	1: 87,627,397 (GRCm39)	L566Q	probably damaging	Het
Mtch2	A	G	2: 90,679,739 (GRCm39)	T38A	probably benign	Het
Mvb12b	A	T	2: 33,717,754 (GRCm39)	I129N	probably damaging	Het
Npffr2	T	C	5: 89,730,556 (GRCm39)	V162A	probably benign	Het
Or4d10b	A	T	19: 12,036,920 (GRCm39)	N65K	probably damaging	Het
Or5p61	A	T	7: 107,758,409 (GRCm39)	Y224N	probably damaging	Het
Pkhd1	G	A	1: 20,621,244 (GRCm39)	R805C	probably damaging	Het
Ppp4r4	T	C	12: 103,559,364 (GRCm39)	L406P	probably damaging	Het
Prl3d2	A	G	13: 27,311,286 (GRCm39)	D186G	probably damaging	Het
Rfc5	T	C	5: 117,523,463 (GRCm39)	T112A	probably benign	Het
Rnf148	A	G	6: 23,654,483 (GRCm39)	L171P	probably damaging	Het
Slco2a1	G	A	9: 102,954,187 (GRCm39)	V453I	probably benign	Het
Spidr	T	C	16: 15,786,424 (GRCm39)	K440E	probably benign	Het
Syndig1	C	A	2: 149,741,496 (GRCm39)	N27K	probably damaging	Het
Tmem62	C	T	2: 120,829,595 (GRCm39)	T316I	probably benign	Het
Tpgs2	A	T	18: 25,272,081 (GRCm39)	I258N	possibly damaging	Het
Vmn2r78	A	T	7: 86,571,545 (GRCm39)	R452*	probably null	Het
Wasf3	A	T	5: 146,390,227 (GRCm39)	I124F	possibly damaging	Het
Wbp11	T	C	6: 136,797,523 (GRCm39)	T299A	probably benign	Het
Wdr25	T	C	12: 108,990,991 (GRCm39)	S41P	probably damaging	Het
Zfp874b	T	C	13: 67,622,962 (GRCm39)	D116G	possibly damaging	Het

Other mutations in Rps24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02049:Rps24	APN	14	24,541,823 (GRCm39)	missense	probably benign
R1209:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1317:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1363:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1365:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1393:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1427:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1429:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1771:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1776:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R2916:Rps24	UTSW	14	24,542,009 (GRCm39)	missense	probably benign	0.02
R4837:Rps24	UTSW	14	24,541,855 (GRCm39)	missense	possibly damaging	0.93
R6146:Rps24	UTSW	14	24,540,803 (GRCm39)	start gained	probably null
R6249:Rps24	UTSW	14	24,543,530 (GRCm39)	missense	possibly damaging	0.92
R7316:Rps24	UTSW	14	24,540,757 (GRCm39)	unclassified	probably benign
R8402:Rps24	UTSW	14	24,540,829 (GRCm39)	splice site	probably benign
V7732:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATCAGAGTCAAAATGTGGTC -3'
(R):5'- GAACACCACAAGTTTGGCCC -3'

Sequencing Primer
(F):5'- ATCAGAGTCAAAATGTGGTCTTTGTG -3'
(R):5'- GGCCCAAACTGCTTATTGTATC -3'

Posted On

2018-05-04