Incidental Mutation 'R6386:Spidr'
ID515617
Institutional Source Beutler Lab
Gene Symbol Spidr
Ensembl Gene ENSMUSG00000041974
Gene Namescaffolding protein involved in DNA repair
Synonyms2310008H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location15889224-16146851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15968560 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 440 (K440E)
Ref Sequence ENSEMBL: ENSMUSP00000038820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040248]
Predicted Effect probably benign
Transcript: ENSMUST00000040248
AA Change: K440E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000038820
Gene: ENSMUSG00000041974
AA Change: K440E

DomainStartEndE-ValueType
Pfam:DUF4502 11 390 1.8e-177 PFAM
low complexity region 499 508 N/A INTRINSIC
Pfam:DUF4503 540 921 2.2e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229846
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Spidr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Spidr APN 16 15895578 missense probably damaging 1.00
IGL00482:Spidr APN 16 16114969 missense possibly damaging 0.94
IGL01760:Spidr APN 16 15912560 missense possibly damaging 0.71
IGL02142:Spidr APN 16 16048081 missense probably benign 0.25
IGL02392:Spidr APN 16 15889630 makesense probably null
IGL02430:Spidr APN 16 16114910 missense probably damaging 1.00
IGL03110:Spidr APN 16 15889754 missense probably damaging 1.00
R0011:Spidr UTSW 16 15966603 missense probably benign 0.00
R0504:Spidr UTSW 16 16140072 missense possibly damaging 0.73
R0505:Spidr UTSW 16 16037667 missense probably damaging 1.00
R0541:Spidr UTSW 16 15915365 missense probably damaging 1.00
R0675:Spidr UTSW 16 16037634 missense probably damaging 1.00
R0722:Spidr UTSW 16 15912781 missense probably damaging 1.00
R2005:Spidr UTSW 16 16048049 missense probably damaging 1.00
R2133:Spidr UTSW 16 16053273 missense probably benign 0.04
R2249:Spidr UTSW 16 16118923 missense probably damaging 1.00
R2876:Spidr UTSW 16 15912589 splice site probably null
R3087:Spidr UTSW 16 15968619 missense probably damaging 1.00
R3121:Spidr UTSW 16 16140860 missense probably damaging 1.00
R3765:Spidr UTSW 16 15968640 missense probably benign 0.39
R4896:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R4939:Spidr UTSW 16 16140746 nonsense probably null
R5004:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R5042:Spidr UTSW 16 16118903 missense probably benign 0.09
R5736:Spidr UTSW 16 15897298 missense probably damaging 1.00
R5839:Spidr UTSW 16 16037502 missense probably damaging 1.00
R5970:Spidr UTSW 16 16114869 missense probably damaging 1.00
R6084:Spidr UTSW 16 16140024 missense possibly damaging 0.87
R6572:Spidr UTSW 16 15912516 splice site probably null
R7238:Spidr UTSW 16 15966816 missense probably benign 0.10
R7249:Spidr UTSW 16 15966648 missense probably benign 0.00
R7334:Spidr UTSW 16 16114825 critical splice donor site probably null
R7393:Spidr UTSW 16 16146831 start gained probably benign
R7681:Spidr UTSW 16 15895624 missense probably damaging 1.00
R7818:Spidr UTSW 16 16114865 missense probably damaging 1.00
X0025:Spidr UTSW 16 15889752 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCATGACTAAATGCTACTTGAG -3'
(R):5'- CACTCGTTGTTAGGAATGCTG -3'

Sequencing Primer
(F):5'- ACTTGAGCTTTCATATCTTTTGGC -3'
(R):5'- CGTTGTTAGGAATGCTGTAATTTAC -3'
Posted On2018-05-04