Incidental Mutation 'R6386:Atf6b'
ID515618
Institutional Source Beutler Lab
Gene Symbol Atf6b
Ensembl Gene ENSMUSG00000015461
Gene Nameactivating transcription factor 6 beta
SynonymsCreb-rp, ATF6beta, Crebl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34647146-34655074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34651851 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 396 (S396P)
Ref Sequence ENSEMBL: ENSMUSP00000015605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614]
Predicted Effect probably damaging
Transcript: ENSMUST00000015605
AA Change: S396P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461
AA Change: S396P

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173984
AA Change: S399P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461
AA Change: S399P

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174156
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor in the unfolded protein response (UPR) pathway during ER stress. Either as a homodimer or as a heterodimer with ATF6-alpha, the encoded protein binds to the ER stress response element, interacting with nuclear transcription factor Y to activate UPR target genes. The protein is normally found in the membrane of the endoplasmic reticulum; however, under ER stress, the N-terminal cytoplasmic domain is cleaved from the rest of the protein and translocates to the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased cellular sensitivity to thapsigargin and tunicamycin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Atf6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Atf6b APN 17 34649137 missense probably damaging 0.99
IGL02010:Atf6b APN 17 34654652 missense probably benign 0.00
IGL02023:Atf6b APN 17 34651867 missense possibly damaging 0.93
IGL02141:Atf6b APN 17 34653277 missense probably benign 0.01
IGL02511:Atf6b APN 17 34654641 missense probably benign 0.01
IGL03347:Atf6b APN 17 34653240 missense probably damaging 1.00
R0112:Atf6b UTSW 17 34651626 missense probably damaging 0.97
R0285:Atf6b UTSW 17 34650396 unclassified probably benign
R0544:Atf6b UTSW 17 34648299 critical splice donor site probably null
R1618:Atf6b UTSW 17 34647728 nonsense probably null
R1689:Atf6b UTSW 17 34650302 missense probably damaging 0.98
R1823:Atf6b UTSW 17 34648644 missense possibly damaging 0.48
R1996:Atf6b UTSW 17 34652987 critical splice acceptor site probably null
R2057:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R2058:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R2059:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R4290:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4291:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4293:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4880:Atf6b UTSW 17 34654555 missense probably damaging 1.00
R4893:Atf6b UTSW 17 34648612 missense probably damaging 1.00
R5406:Atf6b UTSW 17 34653797 nonsense probably null
R5549:Atf6b UTSW 17 34651683 missense probably damaging 1.00
R5702:Atf6b UTSW 17 34651004 missense possibly damaging 0.93
R6833:Atf6b UTSW 17 34649157 missense probably damaging 1.00
R6834:Atf6b UTSW 17 34649157 missense probably damaging 1.00
R7094:Atf6b UTSW 17 34653816 critical splice donor site probably null
R7205:Atf6b UTSW 17 34653729 missense probably damaging 1.00
R7261:Atf6b UTSW 17 34650818 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAAGAGTACCTGCAAGGCC -3'
(R):5'- GGAATGCTTGTGTAAGTGGAAC -3'

Sequencing Primer
(F):5'- AGTACCTGCAAGGCCTGGAG -3'
(R):5'- TGGAACACAGTGCCCGG -3'
Posted On2018-05-04