Incidental Mutation 'R6386:Tpgs2'
ID515621
Institutional Source Beutler Lab
Gene Symbol Tpgs2
Ensembl Gene ENSMUSG00000024269
Gene Nametubulin polyglutamylase complex subunit 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location25127223-25169007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25139024 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 258 (I258N)
Ref Sequence ENSEMBL: ENSMUSP00000111484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115817] [ENSMUST00000148255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115817
AA Change: I258N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111484
Gene: ENSMUSG00000024269
AA Change: I258N

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
low complexity region 253 264 N/A INTRINSIC
low complexity region 271 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148255
SMART Domains Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Tpgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Tpgs2 APN 18 25140580 missense possibly damaging 0.93
IGL02184:Tpgs2 APN 18 25140573 missense probably damaging 1.00
IGL02234:Tpgs2 APN 18 25149244 critical splice acceptor site probably null
IGL02747:Tpgs2 APN 18 25139145 intron probably benign
PIT4466001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
PIT4472001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
R0004:Tpgs2 UTSW 18 25158238 splice site probably benign
R0139:Tpgs2 UTSW 18 25149185 missense probably damaging 1.00
R0898:Tpgs2 UTSW 18 25149150 missense probably damaging 1.00
R1415:Tpgs2 UTSW 18 25168553 missense probably damaging 1.00
R1590:Tpgs2 UTSW 18 25140573 missense probably damaging 1.00
R1974:Tpgs2 UTSW 18 25140536 missense probably damaging 1.00
R2144:Tpgs2 UTSW 18 25168541 missense possibly damaging 0.93
R4811:Tpgs2 UTSW 18 25129840 intron probably benign
R4851:Tpgs2 UTSW 18 25151248 missense possibly damaging 0.94
R6564:Tpgs2 UTSW 18 25158287 missense probably damaging 0.99
R6788:Tpgs2 UTSW 18 25129870 missense probably benign 0.04
R7112:Tpgs2 UTSW 18 25149137 missense probably damaging 1.00
R7824:Tpgs2 UTSW 18 25129865 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCCTAGCTAATGACAGTGGAAAC -3'
(R):5'- TGTAATGTCTGTACTGTCGCC -3'

Sequencing Primer
(F):5'- TCTCTCAGGAGAATGCCGCTG -3'
(R):5'- AATGTCTGTACTGTCGCCTGCTC -3'
Posted On2018-05-04