Incidental Mutation 'R6386:Tpgs2'
ID 515621
Institutional Source Beutler Lab
Gene Symbol Tpgs2
Ensembl Gene ENSMUSG00000024269
Gene Name tubulin polyglutamylase complex subunit 2
Synonyms 5730494M16Rik, 5730437P09Rik
MMRRC Submission 044535-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6386 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 25260280-25301990 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25272081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 258 (I258N)
Ref Sequence ENSEMBL: ENSMUSP00000111484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115817] [ENSMUST00000148255]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000115817
AA Change: I258N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111484
Gene: ENSMUSG00000024269
AA Change: I258N

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
low complexity region 253 264 N/A INTRINSIC
low complexity region 271 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148255
SMART Domains Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,792,311 (GRCm39) probably benign Het
Arap2 A T 5: 62,761,865 (GRCm39) N1620K possibly damaging Het
Atf6b T C 17: 34,870,825 (GRCm39) S396P probably damaging Het
Cc2d1a A G 8: 84,865,166 (GRCm39) M469T probably damaging Het
Ceacam3 A G 7: 16,892,144 (GRCm39) N296D probably benign Het
Cep57l1 A T 10: 41,619,128 (GRCm39) S80T probably damaging Het
Clip4 C A 17: 72,141,189 (GRCm39) Y514* probably null Het
Cop1 T C 1: 159,116,601 (GRCm39) I125T probably damaging Het
Cstf1 T C 2: 172,219,816 (GRCm39) V309A probably damaging Het
Cyp4a29 T G 4: 115,104,272 (GRCm39) probably null Het
F830045P16Rik G A 2: 129,314,738 (GRCm39) H180Y probably damaging Het
Foxp4 T C 17: 48,189,387 (GRCm39) K237E unknown Het
Fstl5 A T 3: 76,229,373 (GRCm39) H58L probably benign Het
Gje1 A G 10: 14,592,365 (GRCm39) F139S probably damaging Het
Gpatch1 T C 7: 34,991,265 (GRCm39) D593G probably damaging Het
Inpp5d T A 1: 87,627,397 (GRCm39) L566Q probably damaging Het
Mtch2 A G 2: 90,679,739 (GRCm39) T38A probably benign Het
Mvb12b A T 2: 33,717,754 (GRCm39) I129N probably damaging Het
Npffr2 T C 5: 89,730,556 (GRCm39) V162A probably benign Het
Or4d10b A T 19: 12,036,920 (GRCm39) N65K probably damaging Het
Or5p61 A T 7: 107,758,409 (GRCm39) Y224N probably damaging Het
Pkhd1 G A 1: 20,621,244 (GRCm39) R805C probably damaging Het
Ppp4r4 T C 12: 103,559,364 (GRCm39) L406P probably damaging Het
Prl3d2 A G 13: 27,311,286 (GRCm39) D186G probably damaging Het
Rfc5 T C 5: 117,523,463 (GRCm39) T112A probably benign Het
Rnf148 A G 6: 23,654,483 (GRCm39) L171P probably damaging Het
Rps24 G A 14: 24,542,116 (GRCm39) G71S possibly damaging Het
Slco2a1 G A 9: 102,954,187 (GRCm39) V453I probably benign Het
Spidr T C 16: 15,786,424 (GRCm39) K440E probably benign Het
Syndig1 C A 2: 149,741,496 (GRCm39) N27K probably damaging Het
Tmem62 C T 2: 120,829,595 (GRCm39) T316I probably benign Het
Vmn2r78 A T 7: 86,571,545 (GRCm39) R452* probably null Het
Wasf3 A T 5: 146,390,227 (GRCm39) I124F possibly damaging Het
Wbp11 T C 6: 136,797,523 (GRCm39) T299A probably benign Het
Wdr25 T C 12: 108,990,991 (GRCm39) S41P probably damaging Het
Zfp874b T C 13: 67,622,962 (GRCm39) D116G possibly damaging Het
Other mutations in Tpgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Tpgs2 APN 18 25,273,637 (GRCm39) missense possibly damaging 0.93
IGL02184:Tpgs2 APN 18 25,273,630 (GRCm39) missense probably damaging 1.00
IGL02234:Tpgs2 APN 18 25,282,301 (GRCm39) critical splice acceptor site probably null
IGL02747:Tpgs2 APN 18 25,272,202 (GRCm39) intron probably benign
PIT4466001:Tpgs2 UTSW 18 25,301,652 (GRCm39) missense possibly damaging 0.77
PIT4472001:Tpgs2 UTSW 18 25,301,652 (GRCm39) missense possibly damaging 0.77
R0004:Tpgs2 UTSW 18 25,291,295 (GRCm39) splice site probably benign
R0139:Tpgs2 UTSW 18 25,282,242 (GRCm39) missense probably damaging 1.00
R0898:Tpgs2 UTSW 18 25,282,207 (GRCm39) missense probably damaging 1.00
R1415:Tpgs2 UTSW 18 25,301,610 (GRCm39) missense probably damaging 1.00
R1590:Tpgs2 UTSW 18 25,273,630 (GRCm39) missense probably damaging 1.00
R1974:Tpgs2 UTSW 18 25,273,593 (GRCm39) missense probably damaging 1.00
R2144:Tpgs2 UTSW 18 25,301,598 (GRCm39) missense possibly damaging 0.93
R4811:Tpgs2 UTSW 18 25,262,897 (GRCm39) intron probably benign
R4851:Tpgs2 UTSW 18 25,284,305 (GRCm39) missense possibly damaging 0.94
R6564:Tpgs2 UTSW 18 25,291,344 (GRCm39) missense probably damaging 0.99
R6788:Tpgs2 UTSW 18 25,262,927 (GRCm39) missense probably benign 0.04
R7112:Tpgs2 UTSW 18 25,282,194 (GRCm39) missense probably damaging 1.00
R7824:Tpgs2 UTSW 18 25,262,922 (GRCm39) missense probably benign
R8722:Tpgs2 UTSW 18 25,274,679 (GRCm39) missense probably benign 0.17
R8808:Tpgs2 UTSW 18 25,284,275 (GRCm39) missense probably damaging 1.00
R8818:Tpgs2 UTSW 18 25,291,365 (GRCm39) missense probably damaging 1.00
R9009:Tpgs2 UTSW 18 25,301,777 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCCTAGCTAATGACAGTGGAAAC -3'
(R):5'- TGTAATGTCTGTACTGTCGCC -3'

Sequencing Primer
(F):5'- TCTCTCAGGAGAATGCCGCTG -3'
(R):5'- AATGTCTGTACTGTCGCCTGCTC -3'
Posted On 2018-05-04