Incidental Mutation 'R6386:Olfr1424'
ID515622
Institutional Source Beutler Lab
Gene Symbol Olfr1424
Ensembl Gene ENSMUSG00000067528
Gene Nameolfactory receptor 1424
SynonymsGA_x6K02T2RE5P-2418550-2417609, MOR239-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12058624-12062682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12059556 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 65 (N65K)
Ref Sequence ENSEMBL: ENSMUSP00000146552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087830] [ENSMUST00000207681]
Predicted Effect probably damaging
Transcript: ENSMUST00000087830
AA Change: N65K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085132
Gene: ENSMUSG00000067528
AA Change: N65K

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 2.4e-47 PFAM
Pfam:7tm_1 41 306 2.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207681
AA Change: N65K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Olfr1424
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Olfr1424 APN 19 12058889 missense possibly damaging 0.96
IGL02095:Olfr1424 APN 19 12059549 missense probably benign 0.00
IGL02743:Olfr1424 APN 19 12059447 missense probably damaging 1.00
IGL02745:Olfr1424 APN 19 12059201 missense probably benign 0.05
R0834:Olfr1424 UTSW 19 12059615 missense probably benign 0.00
R1474:Olfr1424 UTSW 19 12059480 missense probably benign 0.30
R5590:Olfr1424 UTSW 19 12059278 missense probably benign 0.01
R6864:Olfr1424 UTSW 19 12059413 missense probably damaging 1.00
Z1088:Olfr1424 UTSW 19 12059129 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCGATCTAGAGCCATCACAGAC -3'
(R):5'- AGGAGCTTCTGAATTGTGCCC -3'

Sequencing Primer
(F):5'- GAGCCATCACAGACAGAGAAAATGC -3'
(R):5'- TCTGAATTGTGCCCTAAGAGC -3'
Posted On2018-05-04