Incidental Mutation 'R6388:Ciao1'
ID515626
Institutional Source Beutler Lab
Gene Symbol Ciao1
Ensembl Gene ENSMUSG00000003662
Gene Namecytosolic iron-sulfur protein assembly 1
SynonymsWdr39
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127240938-127247816 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 127246476 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 142 (C142*)
Ref Sequence ENSEMBL: ENSMUSP00000134159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003759] [ENSMUST00000035871] [ENSMUST00000172636] [ENSMUST00000174030] [ENSMUST00000174288] [ENSMUST00000174503] [ENSMUST00000174863]
Predicted Effect probably null
Transcript: ENSMUST00000003759
AA Change: C142*
SMART Domains Protein: ENSMUSP00000003759
Gene: ENSMUSG00000003662
AA Change: C142*

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
WD40 240 280 8.04e-4 SMART
WD40 291 332 5.26e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035871
SMART Domains Protein: ENSMUSP00000035434
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 179 3e-98 BLAST
low complexity region 202 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143575
Predicted Effect probably benign
Transcript: ENSMUST00000172636
SMART Domains Protein: ENSMUSP00000134199
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174030
AA Change: C142*
SMART Domains Protein: ENSMUSP00000134189
Gene: ENSMUSG00000003662
AA Change: C142*

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174288
SMART Domains Protein: ENSMUSP00000134629
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
Blast:Sec63 1 95 1e-60 BLAST
low complexity region 118 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174503
SMART Domains Protein: ENSMUSP00000133701
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 124 8e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000174863
AA Change: C142*
SMART Domains Protein: ENSMUSP00000134159
Gene: ENSMUSG00000003662
AA Change: C142*

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 176 1.38e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Ciao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Ciao1 APN 2 127242835 missense probably benign
R1662:Ciao1 UTSW 2 127244937 missense probably benign 0.01
R1703:Ciao1 UTSW 2 127245819 missense probably benign 0.37
R1935:Ciao1 UTSW 2 127246460 missense possibly damaging 0.95
R1940:Ciao1 UTSW 2 127246460 missense possibly damaging 0.95
R2427:Ciao1 UTSW 2 127246691 missense probably damaging 1.00
R5891:Ciao1 UTSW 2 127247134 missense probably benign 0.08
R6295:Ciao1 UTSW 2 127246456 missense probably damaging 1.00
R7211:Ciao1 UTSW 2 127247008 critical splice donor site probably null
R7448:Ciao1 UTSW 2 127245758 missense probably damaging 0.99
R7572:Ciao1 UTSW 2 127246711 nonsense probably null
R8145:Ciao1 UTSW 2 127245806 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTTCCCATATCAAACCCTGTCAGAG -3'
(R):5'- AGGTCAAGTCAGTGGCTTGG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGACAGTCC -3'
(R):5'- CCATCTGGCAACCTCTTGG -3'
Posted On2018-05-04