Incidental Mutation 'R6388:Smarcd3'
ID515628
Institutional Source Beutler Lab
Gene Symbol Smarcd3
Ensembl Gene ENSMUSG00000028949
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3
SynonymsBAF60C, 1500001J14Rik, 2210409C08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24590818-24624411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24596026 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 128 (F128L)
Ref Sequence ENSEMBL: ENSMUSP00000030791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030791
AA Change: F128L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949
AA Change: F128L

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088295
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102432
Predicted Effect probably benign
Transcript: ENSMUST00000121863
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147857
Predicted Effect possibly damaging
Transcript: ENSMUST00000195943
AA Change: F99L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949
AA Change: F99L

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197933
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Smarcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Smarcd3 APN 5 24593719 missense probably damaging 1.00
R0135:Smarcd3 UTSW 5 24595499 unclassified probably benign
R1614:Smarcd3 UTSW 5 24594876 missense possibly damaging 0.93
R1617:Smarcd3 UTSW 5 24595194 missense probably damaging 1.00
R1753:Smarcd3 UTSW 5 24595822 nonsense probably null
R1879:Smarcd3 UTSW 5 24593021 missense probably damaging 0.99
R2307:Smarcd3 UTSW 5 24595748 missense probably damaging 1.00
R3800:Smarcd3 UTSW 5 24593227 nonsense probably null
R4592:Smarcd3 UTSW 5 24592804 missense probably benign 0.00
R6369:Smarcd3 UTSW 5 24594984 missense probably damaging 0.99
R7077:Smarcd3 UTSW 5 24594962 missense probably damaging 1.00
R7078:Smarcd3 UTSW 5 24593069 missense probably damaging 0.98
R7341:Smarcd3 UTSW 5 24595437 missense possibly damaging 0.95
R7426:Smarcd3 UTSW 5 24595812 missense probably benign 0.30
R7806:Smarcd3 UTSW 5 24593262 missense probably benign 0.45
RF007:Smarcd3 UTSW 5 24596070 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCTTCGCAGGGTTAAAAG -3'
(R):5'- AGGATTCCACAGCCTGAAATC -3'

Sequencing Primer
(F):5'- CGCTTTTGCTGTGGAAATAAAG -3'
(R):5'- GGATTCCACAGCCTGAAATCAATTGG -3'
Posted On2018-05-04