Incidental Mutation 'R6388:Nos1'
ID515630
Institutional Source Beutler Lab
Gene Symbol Nos1
Ensembl Gene ENSMUSG00000029361
Gene Namenitric oxide synthase 1, neuronal
SynonymsbNOS, nNOS, 2310005C01Rik, Nos-1, NO
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location117781032-117958840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117914436 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 837 (E837G)
Ref Sequence ENSEMBL: ENSMUSP00000127432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000142742] [ENSMUST00000171055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086451
AA Change: E837G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: E837G

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 1e-226 PFAM
Pfam:Flavodoxin_1 757 930 3.5e-56 PFAM
Pfam:FAD_binding_1 985 1214 1.1e-84 PFAM
Pfam:NAD_binding_1 1246 1360 2.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102557
AA Change: E837G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: E837G

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 350 712 2e-196 PFAM
Pfam:Flavodoxin_1 757 964 2.3e-55 PFAM
Pfam:FAD_binding_1 1019 1248 2.9e-88 PFAM
Pfam:NAD_binding_1 1280 1394 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138554
Predicted Effect possibly damaging
Transcript: ENSMUST00000142742
AA Change: E837G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: E837G

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171055
AA Change: E837G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: E837G

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Nos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nos1 APN 5 117910100 missense probably damaging 0.99
IGL01155:Nos1 APN 5 117945926 missense probably damaging 0.99
IGL01462:Nos1 APN 5 117867709 missense probably benign 0.10
IGL01464:Nos1 APN 5 117943192 missense probably damaging 1.00
IGL01620:Nos1 APN 5 117905309 critical splice acceptor site probably null
IGL01621:Nos1 APN 5 117945884 missense probably damaging 1.00
IGL01796:Nos1 APN 5 117938274 nonsense probably null
IGL02003:Nos1 APN 5 117905465 missense probably damaging 1.00
IGL02274:Nos1 APN 5 117897780 missense probably damaging 1.00
IGL02885:Nos1 APN 5 117895790 missense probably damaging 1.00
IGL02947:Nos1 APN 5 117943317 missense probably damaging 0.99
IGL03088:Nos1 APN 5 117867258 missense probably damaging 1.00
IGL03166:Nos1 APN 5 117914452 splice site probably benign
squanderer UTSW 5 117910238 missense probably damaging 0.97
R0007:Nos1 UTSW 5 117910088 missense probably damaging 1.00
R0012:Nos1 UTSW 5 117893902 missense probably damaging 1.00
R0080:Nos1 UTSW 5 117893878 missense probably damaging 1.00
R0212:Nos1 UTSW 5 117910212 missense possibly damaging 0.57
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0454:Nos1 UTSW 5 117943320 missense probably benign 0.00
R0494:Nos1 UTSW 5 117905474 missense probably damaging 1.00
R0882:Nos1 UTSW 5 117947447 missense probably damaging 1.00
R1099:Nos1 UTSW 5 117923395 missense probably damaging 0.96
R1243:Nos1 UTSW 5 117905472 missense probably damaging 1.00
R1387:Nos1 UTSW 5 117953783 splice site probably benign
R1432:Nos1 UTSW 5 117949619 splice site probably benign
R1698:Nos1 UTSW 5 117867232 missense probably benign 0.01
R1710:Nos1 UTSW 5 117895919 missense probably damaging 1.00
R1859:Nos1 UTSW 5 117905462 missense possibly damaging 0.83
R1973:Nos1 UTSW 5 117936426 missense possibly damaging 0.52
R2084:Nos1 UTSW 5 117943245 missense probably damaging 1.00
R2112:Nos1 UTSW 5 117936571 missense probably benign 0.00
R4689:Nos1 UTSW 5 117879385 missense probably benign 0.04
R4769:Nos1 UTSW 5 117943245 nonsense probably null
R4893:Nos1 UTSW 5 117952877 missense possibly damaging 0.50
R4916:Nos1 UTSW 5 117947570 critical splice donor site probably null
R4956:Nos1 UTSW 5 117947510 missense probably benign
R4971:Nos1 UTSW 5 117943834 missense probably benign 0.05
R4987:Nos1 UTSW 5 117926533 critical splice donor site probably null
R5015:Nos1 UTSW 5 117867269 missense probably damaging 1.00
R5031:Nos1 UTSW 5 117879313 missense probably benign
R5137:Nos1 UTSW 5 117905313 missense probably benign 0.29
R5481:Nos1 UTSW 5 117867754 missense probably benign 0.06
R5541:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R5655:Nos1 UTSW 5 117923257 missense probably damaging 1.00
R5866:Nos1 UTSW 5 117895902 missense probably damaging 0.97
R5934:Nos1 UTSW 5 117936445 missense probably damaging 0.99
R6158:Nos1 UTSW 5 117867574 missense probably benign 0.05
R6225:Nos1 UTSW 5 117912852 missense probably damaging 1.00
R6261:Nos1 UTSW 5 117936570 missense probably benign
R6987:Nos1 UTSW 5 117895785 missense probably benign 0.05
R7104:Nos1 UTSW 5 117947431 missense probably damaging 1.00
R7136:Nos1 UTSW 5 117895860 missense possibly damaging 0.95
R7276:Nos1 UTSW 5 117910238 missense probably damaging 0.97
R7299:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7301:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7402:Nos1 UTSW 5 117949815 missense probably benign 0.34
R7408:Nos1 UTSW 5 117867518 missense probably damaging 1.00
R7618:Nos1 UTSW 5 117903944 missense probably benign 0.01
R7689:Nos1 UTSW 5 117897727 missense probably damaging 0.98
X0025:Nos1 UTSW 5 117943825 missense probably benign 0.00
X0026:Nos1 UTSW 5 117943152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTTGGGTTGAACCTGC -3'
(R):5'- ATTTGAGTCAGAGACCAGAACGTC -3'

Sequencing Primer
(F):5'- TTGAACCTGCAGCTGGGG -3'
(R):5'- TCAGCCACGGTGAAGCC -3'
Posted On2018-05-04