Incidental Mutation 'R6388:Vmn1r13'
ID515633
Institutional Source Beutler Lab
Gene Symbol Vmn1r13
Ensembl Gene ENSMUSG00000064259
Gene Namevomeronasal 1 receptor 13
SynonymsV1rc5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location57203290-57214799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57209918 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 21 (F21I)
Ref Sequence ENSEMBL: ENSMUSP00000154429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078885] [ENSMUST00000226892] [ENSMUST00000227298] [ENSMUST00000227421]
Predicted Effect probably benign
Transcript: ENSMUST00000078885
AA Change: F21I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077924
Gene: ENSMUSG00000064259
AA Change: F21I

DomainStartEndE-ValueType
Pfam:V1R 28 294 3.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226892
AA Change: F21I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000227298
AA Change: F21I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000227421
AA Change: F21I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Vmn1r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Vmn1r13 APN 6 57210113 missense probably benign 0.10
IGL01511:Vmn1r13 APN 6 57210329 missense probably benign 0.00
IGL02412:Vmn1r13 APN 6 57210489 missense possibly damaging 0.46
IGL02455:Vmn1r13 APN 6 57210472 missense probably damaging 1.00
IGL03046:Vmn1r13 APN 6 57210732 missense probably benign
R0285:Vmn1r13 UTSW 6 57209994 missense probably benign 0.06
R0304:Vmn1r13 UTSW 6 57210626 missense probably benign 0.01
R0385:Vmn1r13 UTSW 6 57210705 missense probably benign 0.06
R0402:Vmn1r13 UTSW 6 57210098 missense possibly damaging 0.96
R0544:Vmn1r13 UTSW 6 57210263 missense probably benign
R0960:Vmn1r13 UTSW 6 57210011 missense probably benign 0.06
R1297:Vmn1r13 UTSW 6 57210407 missense probably damaging 0.99
R4056:Vmn1r13 UTSW 6 57209985 missense probably benign 0.03
R5108:Vmn1r13 UTSW 6 57209916 missense probably benign 0.33
R7136:Vmn1r13 UTSW 6 57210254 missense possibly damaging 0.93
R7204:Vmn1r13 UTSW 6 57210156 missense probably benign 0.13
R7239:Vmn1r13 UTSW 6 57210626 missense probably benign 0.01
R7303:Vmn1r13 UTSW 6 57210602 missense probably damaging 1.00
R7997:Vmn1r13 UTSW 6 57210344 missense possibly damaging 0.81
X0066:Vmn1r13 UTSW 6 57210597 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTAGGCCATAATTTACATGCTGG -3'
(R):5'- CCCTGTTTGTGTATAAAGTTGCC -3'

Sequencing Primer
(F):5'- GGCCATAATTTACATGCTGGAAAACC -3'
(R):5'- AGTTGCCTTACATTTGATGTCATTC -3'
Posted On2018-05-04