Incidental Mutation 'R6388:Car5a'
ID515636
Institutional Source Beutler Lab
Gene Symbol Car5a
Ensembl Gene ENSMUSG00000025317
Gene Namecarbonic anhydrase 5a, mitochondrial
SynonymsCar5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6388 (G1)
Quality Score177.009
Status Validated
Chromosome8
Chromosomal Location121916126-121944904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121927171 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 118 (Y118C)
Ref Sequence ENSEMBL: ENSMUSP00000060457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057653] [ENSMUST00000127664]
PDB Structure
MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AT 2.45 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
COMPLEX BETWEEN MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AND THE TRANSITION STATE ANALOGUE ACETAZOLAMIDE [X-RAY DIFFRACTION]
Crystal Structure of F65A/Y131C Carbonic Anhydrase V, covalently modified with 4-chloromethylimidazole [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE V [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000057653
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060457
Gene: ENSMUSG00000025317
AA Change: Y118C

DomainStartEndE-ValueType
Carb_anhydrase 27 290 6.61e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151462
Meta Mutation Damage Score 0.58 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VA is localized in the mitochondria and expressed primarily in the liver. It may play an important role in ureagenesis and gluconeogenesis. CA5A gene maps to chromosome 16q24.3 and an unprocessed pseudogene has been assigned to 16p12-p11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, hyperammonemia, and increased levels of urinary metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Car5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Car5a APN 8 121923610 missense probably benign 0.07
IGL01972:Car5a APN 8 121927082 critical splice donor site probably null
R0152:Car5a UTSW 8 121916446 missense probably damaging 1.00
R0562:Car5a UTSW 8 121944730 missense probably benign 0.00
R0699:Car5a UTSW 8 121944816 unclassified probably benign
R1827:Car5a UTSW 8 121923808 missense probably benign 0.00
R2274:Car5a UTSW 8 121944669 critical splice donor site probably null
R4261:Car5a UTSW 8 121944749 missense probably benign 0.03
R5436:Car5a UTSW 8 121917242 intron probably benign
R5869:Car5a UTSW 8 121916380 missense probably benign
R5937:Car5a UTSW 8 121939821 missense probably damaging 1.00
R6803:Car5a UTSW 8 121923765 critical splice donor site probably null
R7369:Car5a UTSW 8 121923834 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGCGACAGTGAGGTCTAGTC -3'
(R):5'- TTTTGCAGCACAGCGATCG -3'

Sequencing Primer
(F):5'- ACAGTGAGGTCTAGTCACCCTGTAG -3'
(R):5'- TGTGTAGAAGGTTGCCCCCATC -3'
Posted On2018-05-04