Incidental Mutation 'R6388:Icosl'
ID515637
Institutional Source Beutler Lab
Gene Symbol Icosl
Ensembl Gene ENSMUSG00000000732
Gene Nameicos ligand
SynonymsB7h, B7-H2, B7RP-1, GL50, GL50-B, ICOS-L, LICOS
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R6388 (G1)
Quality Score134.264
Status Validated
Chromosome10
Chromosomal Location78069302-78083913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78069532 bp
ZygosityHomozygous
Amino Acid Change Leucine to Glutamine at position 3 (L3Q)
Ref Sequence ENSEMBL: ENSMUSP00000101032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105393
AA Change: L3Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101032
Gene: ENSMUSG00000000732
AA Change: L3Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
IG 47 161 4.67e-4 SMART
Pfam:C2-set_2 165 253 5.2e-9 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217675
Predicted Effect probably benign
Transcript: ENSMUST00000219038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219633
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit defects in the humoral immune response associated with an impaired interactions between T and B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Icosl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Icosl APN 10 78071971 missense probably damaging 1.00
IGL02540:Icosl APN 10 78069536 critical splice donor site probably null
R0304:Icosl UTSW 10 78075322 missense probably benign
R0512:Icosl UTSW 10 78071966 missense possibly damaging 0.77
R0584:Icosl UTSW 10 78071875 missense possibly damaging 0.82
R0711:Icosl UTSW 10 78073941 missense probably damaging 1.00
R2005:Icosl UTSW 10 78071953 missense possibly damaging 0.63
R2006:Icosl UTSW 10 78071953 missense possibly damaging 0.63
R2189:Icosl UTSW 10 78073925 missense possibly damaging 0.62
R3417:Icosl UTSW 10 78072035 missense possibly damaging 0.46
R4423:Icosl UTSW 10 78071873 missense possibly damaging 0.92
R5183:Icosl UTSW 10 78069485 unclassified probably benign
R5579:Icosl UTSW 10 78073763 missense probably damaging 0.99
R7336:Icosl UTSW 10 78073873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCCGATTGGGTTACTTTCG -3'
(R):5'- AGTTTTCACCTTCAGTACCGG -3'

Sequencing Primer
(F):5'- TGTGCCCAATTAGCCAGG -3'
(R):5'- ACCTTCAGTACCGGCTCTTG -3'
Posted On2018-05-04