Incidental Mutation 'R6388:Ugp2'
ID515640
Institutional Source Beutler Lab
Gene Symbol Ugp2
Ensembl Gene ENSMUSG00000001891
Gene NameUDP-glucose pyrophosphorylase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location21321138-21371201 bp(-) (GRCm38)
Type of Mutationunclassified (1727 bp from exon)
DNA Base Change (assembly) A to G at 21322051 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000060895] [ENSMUST00000102875] [ENSMUST00000109578] [ENSMUST00000132017]
Predicted Effect probably null
Transcript: ENSMUST00000006221
SMART Domains Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 198 364 2.1e-12 PFAM
Pfam:Vps54 736 868 3.3e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060895
AA Change: S489P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056324
Gene: ENSMUSG00000001891
AA Change: S489P

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
Pfam:UDPGP 43 462 2.1e-197 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102875
AA Change: S500P

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099939
Gene: ENSMUSG00000001891
AA Change: S500P

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:UDPGP 55 473 3.5e-201 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109578
SMART Domains Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 186 352 2.3e-12 PFAM
Pfam:Vps54 723 857 1.6e-63 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132017
SMART Domains Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128

DomainStartEndE-ValueType
Pfam:DUF2450 72 238 1.4e-12 PFAM
Pfam:Vps54 573 707 7.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153159
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is an important intermediary in mammalian carbohydrate interconversions. It transfers a glucose moiety from glucose-1-phosphate to MgUTP and forms UDP-glucose and MgPPi. In liver and muscle tissue, UDP-glucose is a direct precursor of glycogen; in lactating mammary gland it is converted to UDP-galactose which is then converted to lactose. The eukaryotic enzyme has no significant sequence similarity to the prokaryotic enzyme. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Ugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ugp2 APN 11 21354345 missense probably benign
IGL01161:Ugp2 APN 11 21323273 missense possibly damaging 0.82
IGL01759:Ugp2 APN 11 21353447 missense probably benign 0.01
IGL03037:Ugp2 APN 11 21332540 nonsense probably null
IGL03092:Ugp2 APN 11 21329722 splice site probably benign
bittern UTSW 11 21322051 unclassified probably null
PIT4377001:Ugp2 UTSW 11 21370203 start codon destroyed probably null 0.33
R1538:Ugp2 UTSW 11 21333791 missense possibly damaging 0.88
R1658:Ugp2 UTSW 11 21333774 missense probably benign
R1771:Ugp2 UTSW 11 21329915 missense probably damaging 1.00
R1874:Ugp2 UTSW 11 21329048 missense probably damaging 1.00
R1970:Ugp2 UTSW 11 21328942 missense probably damaging 0.99
R2143:Ugp2 UTSW 11 21328949 missense probably benign
R2431:Ugp2 UTSW 11 21329025 missense probably damaging 1.00
R3888:Ugp2 UTSW 11 21353366 missense probably benign 0.01
R4352:Ugp2 UTSW 11 21329026 missense probably damaging 0.99
R5018:Ugp2 UTSW 11 21331052 missense probably damaging 1.00
R6125:Ugp2 UTSW 11 21329815 missense probably damaging 0.97
R6466:Ugp2 UTSW 11 21328883 missense probably benign 0.01
R6626:Ugp2 UTSW 11 21331028 missense probably damaging 1.00
R7219:Ugp2 UTSW 11 21323271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTAGACTAAAAGCTCATTGCAG -3'
(R):5'- CTCTTAGGAGACAGCAGGACAC -3'

Sequencing Primer
(F):5'- TAGACTAAAAGCTCATTGCAGAAAAC -3'
(R):5'- ACACATCATGTCCCATTATTGGC -3'
Posted On2018-05-04