Incidental Mutation 'R6388:Olfr395'
ID515642
Institutional Source Beutler Lab
Gene Symbol Olfr395
Ensembl Gene ENSMUSG00000062186
Gene Nameolfactory receptor 395
SynonymsGA_x6K02T2P1NL-4062605-4061667, MOR135-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73903318-73909299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73907292 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 67 (S67P)
Ref Sequence ENSEMBL: ENSMUSP00000149064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072991] [ENSMUST00000215690]
Predicted Effect probably damaging
Transcript: ENSMUST00000072991
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072756
Gene: ENSMUSG00000062186
AA Change: S67P

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Pfam:7tm_4 31 309 6.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.8e-8 PFAM
Pfam:7tm_1 41 290 3.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215690
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5745 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Olfr395
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr395 APN 11 73907313 missense probably damaging 1.00
IGL01618:Olfr395 APN 11 73907477 missense probably damaging 1.00
IGL01995:Olfr395 APN 11 73907435 missense possibly damaging 0.52
IGL02494:Olfr395 APN 11 73906724 missense possibly damaging 0.55
IGL02995:Olfr395 APN 11 73907219 missense possibly damaging 0.90
IGL03256:Olfr395 APN 11 73906696 missense probably benign 0.07
R0018:Olfr395 UTSW 11 73906626 missense probably damaging 1.00
R0701:Olfr395 UTSW 11 73906829 missense probably damaging 1.00
R0839:Olfr395 UTSW 11 73907312 missense probably damaging 0.99
R1222:Olfr395 UTSW 11 73907414 missense probably damaging 1.00
R1737:Olfr395 UTSW 11 73907085 missense possibly damaging 0.69
R1819:Olfr395 UTSW 11 73906679 missense probably benign 0.02
R2994:Olfr395 UTSW 11 73906715 missense probably damaging 1.00
R3195:Olfr395 UTSW 11 73906658 missense possibly damaging 0.91
R4622:Olfr395 UTSW 11 73906911 missense possibly damaging 0.55
R4753:Olfr395 UTSW 11 73906851 missense probably damaging 1.00
R5137:Olfr395 UTSW 11 73906626 missense probably damaging 1.00
R5448:Olfr395 UTSW 11 73906611 missense probably damaging 1.00
R5604:Olfr395 UTSW 11 73907027 missense probably benign 0.02
R5748:Olfr395 UTSW 11 73906895 missense probably damaging 0.98
R5899:Olfr395 UTSW 11 73906929 missense probably damaging 1.00
R6156:Olfr395 UTSW 11 73906621 nonsense probably null
R6572:Olfr395 UTSW 11 73906803 missense possibly damaging 0.91
R7241:Olfr395 UTSW 11 73907232 missense probably benign 0.05
Z1177:Olfr395 UTSW 11 73906613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGATGGCCACATAGC -3'
(R):5'- TTAAGTCATTGGAAGCATGGCTG -3'

Sequencing Primer
(F):5'- CACATAGCGGTCATAGGCCATG -3'
(R):5'- TGGAAAGAACCAAACTCTCATCTTGG -3'
Posted On2018-05-04