Incidental Mutation 'R6388:Gpatch8'
ID515645
Institutional Source Beutler Lab
Gene Symbol Gpatch8
Ensembl Gene ENSMUSG00000034621
Gene NameG patch domain containing 8
SynonymsENSMUSG00000075516, Fbm1, 5430405G24Rik, Gpatc8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location102475915-102556392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102478488 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1408 (V1408E)
Ref Sequence ENSEMBL: ENSMUSP00000120649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143842]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069673
Predicted Effect probably damaging
Transcript: ENSMUST00000143842
AA Change: V1408E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120649
Gene: ENSMUSG00000034621
AA Change: V1408E

DomainStartEndE-ValueType
G_patch 38 84 6.03e-12 SMART
coiled coil region 89 130 N/A INTRINSIC
ZnF_C2H2 136 160 6.4e0 SMART
coiled coil region 183 209 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
internal_repeat_1 307 391 1.55e-5 PROSPERO
low complexity region 474 490 N/A INTRINSIC
internal_repeat_1 583 658 1.55e-5 PROSPERO
low complexity region 666 687 N/A INTRINSIC
low complexity region 691 720 N/A INTRINSIC
low complexity region 722 753 N/A INTRINSIC
low complexity region 761 772 N/A INTRINSIC
low complexity region 798 820 N/A INTRINSIC
low complexity region 829 885 N/A INTRINSIC
low complexity region 887 980 N/A INTRINSIC
low complexity region 988 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1208 1217 N/A INTRINSIC
low complexity region 1326 1342 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1379 1404 N/A INTRINSIC
low complexity region 1438 1452 N/A INTRINSIC
low complexity region 1463 1490 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an RNA-processing domain, a zinc finger domain, a lysine-rich region and a serine-rich region. A mutation in the serine-rich region of the protein is thought to be associated with hyperuricemia (PMID: 21594610). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Gpatch8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Gpatch8 APN 11 102478878 missense probably damaging 1.00
IGL00590:Gpatch8 APN 11 102480549 missense unknown
IGL00835:Gpatch8 APN 11 102478549 missense probably damaging 1.00
IGL00971:Gpatch8 APN 11 102479917 missense unknown
IGL01395:Gpatch8 APN 11 102480708 missense unknown
IGL02386:Gpatch8 APN 11 102508157 missense unknown
IGL02476:Gpatch8 APN 11 102478591 missense probably damaging 1.00
IGL02809:Gpatch8 APN 11 102487590 missense unknown
IGL02985:Gpatch8 APN 11 102481510 missense unknown
IGL03013:Gpatch8 APN 11 102508197 missense unknown
PIT4810001:Gpatch8 UTSW 11 102481842 missense unknown
R0332:Gpatch8 UTSW 11 102481842 missense unknown
R0464:Gpatch8 UTSW 11 102480886 missense unknown
R0710:Gpatch8 UTSW 11 102481933 missense unknown
R0734:Gpatch8 UTSW 11 102481400 missense unknown
R1458:Gpatch8 UTSW 11 102481229 missense unknown
R1919:Gpatch8 UTSW 11 102508142 critical splice donor site probably null
R2007:Gpatch8 UTSW 11 102500831 missense unknown
R2495:Gpatch8 UTSW 11 102478481 missense probably damaging 1.00
R2881:Gpatch8 UTSW 11 102479917 missense unknown
R2939:Gpatch8 UTSW 11 102508184 missense unknown
R4672:Gpatch8 UTSW 11 102478958 missense probably damaging 1.00
R4903:Gpatch8 UTSW 11 102480133 missense unknown
R4931:Gpatch8 UTSW 11 102481224 missense unknown
R5230:Gpatch8 UTSW 11 102479578 missense probably damaging 1.00
R5288:Gpatch8 UTSW 11 102508227 intron probably null
R5384:Gpatch8 UTSW 11 102508227 intron probably null
R5386:Gpatch8 UTSW 11 102508227 intron probably null
R5564:Gpatch8 UTSW 11 102538285 missense unknown
R5668:Gpatch8 UTSW 11 102500867 missense unknown
R5954:Gpatch8 UTSW 11 102480941 missense unknown
R5966:Gpatch8 UTSW 11 102480232 missense unknown
R6018:Gpatch8 UTSW 11 102480915 missense unknown
R6176:Gpatch8 UTSW 11 102487524 missense unknown
R7153:Gpatch8 UTSW 11 102480188 small insertion probably benign
R7155:Gpatch8 UTSW 11 102480188 small insertion probably benign
R7163:Gpatch8 UTSW 11 102480188 small insertion probably benign
R7238:Gpatch8 UTSW 11 102478528 missense probably damaging 1.00
R7407:Gpatch8 UTSW 11 102479830 missense unknown
R7825:Gpatch8 UTSW 11 102481442 missense unknown
Z1088:Gpatch8 UTSW 11 102480945 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTGACCTGAGAAGATGGG -3'
(R):5'- ACAAGTGAAGGCCTTTCCAGC -3'

Sequencing Primer
(F):5'- TGAAGATGGAGGGCTGTGGC -3'
(R):5'- AAGGCCTTTCCAGCCTCCAC -3'
Posted On2018-05-04