Incidental Mutation 'R6388:Clec14a'
ID515646
Institutional Source Beutler Lab
Gene Symbol Clec14a
Ensembl Gene ENSMUSG00000045930
Gene NameC-type lectin domain family 14, member a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location58264720-58269290 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 58267457 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 460 (*460R)
Ref Sequence ENSEMBL: ENSMUSP00000054451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062254]
Predicted Effect probably null
Transcript: ENSMUST00000062254
AA Change: *460R
SMART Domains Protein: ENSMUSP00000054451
Gene: ENSMUSG00000045930
AA Change: *460R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 172 1.4e-5 SMART
EGF 246 288 1.85e0 SMART
transmembrane domain 388 410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This family member plays a role in cell-cell adhesion and angiogenesis. It functions in filopodia formation, cell migration and tube formation. Due to its presence at higher levels in tumor endothelium than in normal tissue endothelium, it is considered to be a candidate for tumor vascular targeting. [provided by RefSeq, Jan 2012]
PHENOTYPE: No notable pheontype was detected in a high-throughput screen of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Clec14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Clec14a APN 12 58268318 missense probably damaging 1.00
IGL02109:Clec14a APN 12 58268148 missense probably benign 0.00
IGL02121:Clec14a APN 12 58268437 missense probably damaging 1.00
IGL02136:Clec14a APN 12 58268629 missense probably damaging 1.00
IGL02818:Clec14a APN 12 58268102 missense probably damaging 1.00
R0379:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R0382:Clec14a UTSW 12 58268617 missense probably damaging 1.00
R0419:Clec14a UTSW 12 58267665 missense probably damaging 0.97
R2972:Clec14a UTSW 12 58267574 missense probably damaging 1.00
R3796:Clec14a UTSW 12 58267909 missense probably benign 0.34
R3797:Clec14a UTSW 12 58267909 missense probably benign 0.34
R3876:Clec14a UTSW 12 58268644 missense possibly damaging 0.79
R4602:Clec14a UTSW 12 58267981 missense probably benign 0.03
R4708:Clec14a UTSW 12 58267703 missense probably benign 0.00
R4994:Clec14a UTSW 12 58268284 missense probably damaging 1.00
R5193:Clec14a UTSW 12 58268614 missense probably damaging 1.00
R5489:Clec14a UTSW 12 58268249 missense probably damaging 1.00
R5671:Clec14a UTSW 12 58267826 missense probably benign 0.05
R6318:Clec14a UTSW 12 58268215 missense probably damaging 1.00
R6828:Clec14a UTSW 12 58268504 missense probably damaging 1.00
R7065:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R7418:Clec14a UTSW 12 58268647 missense probably damaging 0.99
R7635:Clec14a UTSW 12 58268528 missense probably damaging 1.00
R7666:Clec14a UTSW 12 58267757 missense probably benign 0.05
R7908:Clec14a UTSW 12 58267679 missense possibly damaging 0.63
R7989:Clec14a UTSW 12 58267679 missense possibly damaging 0.63
X0024:Clec14a UTSW 12 58268326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCAGGGAACAAGTGTCTC -3'
(R):5'- CCACGGTGGTCTTCATACTTG -3'

Sequencing Primer
(F):5'- CAGGGAACAAGTGTCTCTTTCAG -3'
(R):5'- GTCTTCATACTTGTGAGCATAGCAG -3'
Posted On2018-05-04