Incidental Mutation 'R6388:Fastkd3'
ID515647
Institutional Source Beutler Lab
Gene Symbol Fastkd3
Ensembl Gene ENSMUSG00000021532
Gene NameFAST kinase domains 3
Synonyms2310010B21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location68582234-68592338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68590200 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 623 (L623F)
Ref Sequence ENSEMBL: ENSMUSP00000061737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051784] [ENSMUST00000223319]
Predicted Effect probably damaging
Transcript: ENSMUST00000051784
AA Change: L623F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061737
Gene: ENSMUSG00000021532
AA Change: L623F

DomainStartEndE-ValueType
low complexity region 178 189 N/A INTRINSIC
Pfam:FAST_1 410 478 2.9e-22 PFAM
Pfam:FAST_2 491 581 3.1e-28 PFAM
RAP 594 651 7.58e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221006
Predicted Effect unknown
Transcript: ENSMUST00000221640
AA Change: L26F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222068
Predicted Effect probably benign
Transcript: ENSMUST00000222685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223128
Predicted Effect probably benign
Transcript: ENSMUST00000223319
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of Fas-activated serine/threonine kinase domain (FASTKD) containing proteins that share an amino terminal mitochondrial targeting domain and multiple carboxy terminal FAST domains as well as a putative RNA-binding RAP domain. The members of this family are ubiquitously expressed and are generally most abundant in mitochondria-enriched tissues such as heart, skeletal muscle and brown-adipose tissue. Some members of this protein family may play a role in apoptosis. The protein encoded by this gene interacts with components of the mitochondrial respiratory and translation networks. A pseudogene of this gene is also present on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Fastkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Fastkd3 APN 13 68584528 missense possibly damaging 0.87
IGL01839:Fastkd3 APN 13 68584852 missense probably benign 0.19
IGL02268:Fastkd3 APN 13 68583677 missense probably damaging 0.96
IGL03412:Fastkd3 APN 13 68583721 missense probably benign 0.01
R0681:Fastkd3 UTSW 13 68591928 splice site probably benign
R1282:Fastkd3 UTSW 13 68584557 missense possibly damaging 0.76
R1987:Fastkd3 UTSW 13 68585241 missense possibly damaging 0.92
R3081:Fastkd3 UTSW 13 68584868 missense probably benign 0.38
R4153:Fastkd3 UTSW 13 68590138 missense probably damaging 1.00
R5339:Fastkd3 UTSW 13 68590164 missense probably damaging 1.00
R5384:Fastkd3 UTSW 13 68584585 missense probably benign 0.09
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6109:Fastkd3 UTSW 13 68590218 nonsense probably null
R6123:Fastkd3 UTSW 13 68590218 nonsense probably null
R6124:Fastkd3 UTSW 13 68590218 nonsense probably null
R6299:Fastkd3 UTSW 13 68587736 missense probably damaging 0.97
R6561:Fastkd3 UTSW 13 68584030 missense possibly damaging 0.95
R7214:Fastkd3 UTSW 13 68589380 missense probably benign 0.12
R7446:Fastkd3 UTSW 13 68591960 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTTGCAAATAACTGACACATAGAGC -3'
(R):5'- ACAAGTGAAACTAGGGGCATTC -3'

Sequencing Primer
(F):5'- AGCTAGTAAGGTGTACTTTGAATCG -3'
(R):5'- TAGGGGCATTCCTACAAGACCTC -3'
Posted On2018-05-04