Incidental Mutation 'R6388:Syvn1'
ID515657
Institutional Source Beutler Lab
Gene Symbol Syvn1
Ensembl Gene ENSMUSG00000024807
Gene Namesynovial apoptosis inhibitor 1, synoviolin
Synonyms1200010C09Rik, Hrd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6046576-6053712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6052351 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 483 (V483E)
Ref Sequence ENSEMBL: ENSMUSP00000025723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007482] [ENSMUST00000025723] [ENSMUST00000129081] [ENSMUST00000134667] [ENSMUST00000138532] [ENSMUST00000156550]
Predicted Effect probably benign
Transcript: ENSMUST00000007482
SMART Domains Protein: ENSMUSP00000007482
Gene: ENSMUSG00000007338

DomainStartEndE-ValueType
Pfam:Img2 82 166 5.1e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025723
AA Change: V483E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025723
Gene: ENSMUSG00000024807
AA Change: V483E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
transmembrane domain 159 181 N/A INTRINSIC
RING 240 278 4.7e-10 SMART
low complexity region 286 357 N/A INTRINSIC
low complexity region 365 426 N/A INTRINSIC
low complexity region 488 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129081
SMART Domains Protein: ENSMUSP00000118698
Gene: ENSMUSG00000024807

DomainStartEndE-ValueType
transmembrane domain 5 25 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134667
AA Change: V534E
SMART Domains Protein: ENSMUSP00000114960
Gene: ENSMUSG00000024807
AA Change: V534E

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 579 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000138532
AA Change: V534E
SMART Domains Protein: ENSMUSP00000114843
Gene: ENSMUSG00000024807
AA Change: V534E

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144328
Predicted Effect unknown
Transcript: ENSMUST00000156550
AA Change: V534E
SMART Domains Protein: ENSMUSP00000121885
Gene: ENSMUSG00000024807
AA Change: V534E

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184338
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in endoplasmic reticulum (ER)-associated degradation. The encoded protein removes unfolded proteins, accumulated during ER stress, by retrograde transport to the cytosol from the ER. This protein also uses the ubiquitin-proteasome system for additional degradation of unfolded proteins. Sequence analysis identified two transcript variants that encode different isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Haploinsufficiency results in embryonic death due to systemic abnormal apoptosis. Mice are viable when only a single copy is inactivated and they exhibit a resistance to collagen-induced arthritis due to enhanced apoptosis of synovial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Syvn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Syvn1 APN 19 6052407 missense probably benign 0.00
IGL02004:Syvn1 APN 19 6052407 missense probably benign 0.00
IGL02218:Syvn1 APN 19 6050199 missense probably damaging 1.00
IGL02335:Syvn1 APN 19 6050093 critical splice donor site probably null
IGL02385:Syvn1 APN 19 6048540 missense probably damaging 1.00
IGL02700:Syvn1 APN 19 6047943 missense probably benign 0.03
IGL02904:Syvn1 APN 19 6049815 nonsense probably null
R0833:Syvn1 UTSW 19 6052453 missense probably benign 0.04
R1886:Syvn1 UTSW 19 6049227 missense possibly damaging 0.84
R2031:Syvn1 UTSW 19 6050530 missense probably damaging 1.00
R4299:Syvn1 UTSW 19 6049921 intron probably benign
R4347:Syvn1 UTSW 19 6049921 intron probably benign
R4422:Syvn1 UTSW 19 6049921 intron probably benign
R4423:Syvn1 UTSW 19 6049921 intron probably benign
R4424:Syvn1 UTSW 19 6049921 intron probably benign
R4425:Syvn1 UTSW 19 6049921 intron probably benign
R4647:Syvn1 UTSW 19 6051474 missense probably benign 0.13
R5960:Syvn1 UTSW 19 6050568 missense probably damaging 1.00
R6940:Syvn1 UTSW 19 6051184 unclassified probably benign
R7728:Syvn1 UTSW 19 6051205 missense unknown
Predicted Primers PCR Primer
(F):5'- TGATAATCCAATCCGCCTATTCAC -3'
(R):5'- ACAATGCCCACTGACTCAGG -3'

Sequencing Primer
(F):5'- TCACTTATACTTACTCGTCACAAGG -3'
(R):5'- CCACTGACTCAGGAGCTAGAAG -3'
Posted On2018-05-04