Incidental Mutation 'R6388:Ppp1r32'
ID515658
Institutional Source Beutler Lab
Gene Symbol Ppp1r32
Ensembl Gene ENSMUSG00000035179
Gene Nameprotein phosphatase 1, regulatory subunit 32
SynonymsIIIG9L, 4930579J09Rik, IIIG9S, IIIG9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10474257-10482897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10482301 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000035684 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000038842
AA Change: V14A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ube3a C T 7: 59,304,921 probably null Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Ppp1r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp1r32 APN 19 10477523 critical splice donor site probably null
IGL00979:Ppp1r32 APN 19 10474499 makesense probably null
IGL02405:Ppp1r32 APN 19 10474566 missense probably damaging 1.00
IGL02664:Ppp1r32 APN 19 10482291 missense probably damaging 1.00
IGL03105:Ppp1r32 APN 19 10477020 splice site probably benign
R0255:Ppp1r32 UTSW 19 10475054 missense probably damaging 1.00
R0268:Ppp1r32 UTSW 19 10477085 missense possibly damaging 0.88
R1018:Ppp1r32 UTSW 19 10479460 splice site probably benign
R1559:Ppp1r32 UTSW 19 10481406 missense probably benign 0.01
R2384:Ppp1r32 UTSW 19 10481282 critical splice donor site probably null
R4362:Ppp1r32 UTSW 19 10475021 missense probably damaging 1.00
R4884:Ppp1r32 UTSW 19 10474501 makesense probably null
R5998:Ppp1r32 UTSW 19 10481352 missense possibly damaging 0.50
R6130:Ppp1r32 UTSW 19 10477764 missense probably benign 0.16
R6360:Ppp1r32 UTSW 19 10479481 missense probably damaging 1.00
R6625:Ppp1r32 UTSW 19 10481736 missense probably damaging 0.97
R6754:Ppp1r32 UTSW 19 10477089 missense probably damaging 1.00
R7188:Ppp1r32 UTSW 19 10482338 missense probably benign 0.15
R7361:Ppp1r32 UTSW 19 10479579 missense probably damaging 1.00
R7679:Ppp1r32 UTSW 19 10482254 missense probably damaging 1.00
R8157:Ppp1r32 UTSW 19 10478265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGGCAGGTCACTCTCTG -3'
(R):5'- CATGCCAGTGTGAGAGTTGAAG -3'

Sequencing Primer
(F):5'- CTCTGCTCAGATTGACCTAGAGTG -3'
(R):5'- ACTTGGGATGCAGTTTCCAG -3'
Posted On2018-05-04