Incidental Mutation 'R6389:Ly9'
ID515664
Institutional Source Beutler Lab
Gene Symbol Ly9
Ensembl Gene ENSMUSG00000004707
Gene Namelymphocyte antigen 9
SynonymsT100, CD229, Lgp100, SLAMF3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location171588624-171607410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 171596537 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 482 (S482C)
Ref Sequence ENSEMBL: ENSMUSP00000106908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004827] [ENSMUST00000068878] [ENSMUST00000111277] [ENSMUST00000143463] [ENSMUST00000194797]
Predicted Effect probably damaging
Transcript: ENSMUST00000004827
AA Change: S372C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004827
Gene: ENSMUSG00000004707
AA Change: S372C

DomainStartEndE-ValueType
Pfam:Ig_3 46 116 7.9e-9 PFAM
Pfam:Ig_2 46 129 5.4e-10 PFAM
IG 143 246 1.49e-2 SMART
Pfam:Ig_3 251 320 4.1e-13 PFAM
Pfam:Ig_2 251 330 7.5e-6 PFAM
transmembrane domain 345 364 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068878
AA Change: S482C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069319
Gene: ENSMUSG00000004707
AA Change: S482C

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 5.6e-8 PFAM
Pfam:Ig_2 156 239 4e-8 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5.4e-10 PFAM
low complexity region 433 441 N/A INTRINSIC
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111277
AA Change: S482C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106908
Gene: ENSMUSG00000004707
AA Change: S482C

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 9.9e-9 PFAM
Pfam:Ig_2 156 239 6.8e-10 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5e-13 PFAM
Pfam:Ig_2 361 440 9.4e-6 PFAM
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143463
SMART Domains Protein: ENSMUSP00000137924
Gene: ENSMUSG00000004707

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146596
Predicted Effect probably benign
Transcript: ENSMUST00000194797
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]).[supplied by OMIM, Mar 2008]
PHENOTYPE: This locus controls an antigen on thymocytes, lymphocytes and bone marrow cells. The a allele determines Ly9.1 antigen in A/J, 129/Re, BALB/c and C3H/He; the b allele determines antigen Ly9.2 in the C57 family of strains, HTI/Go, MA/My, F/St and C58/Lw. Null mutants are viable, healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Ly9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ly9 APN 1 171593451 missense probably damaging 1.00
IGL00640:Ly9 APN 1 171601879 missense possibly damaging 0.65
IGL01899:Ly9 APN 1 171607247 missense probably damaging 0.99
IGL02714:Ly9 APN 1 171605118 missense possibly damaging 0.60
IGL03086:Ly9 APN 1 171605170 missense probably benign 0.01
R0647:Ly9 UTSW 1 171599808 missense probably damaging 1.00
R1292:Ly9 UTSW 1 171589103 splice site probably null
R1422:Ly9 UTSW 1 171601212 missense probably damaging 1.00
R1598:Ly9 UTSW 1 171596507 missense probably benign 0.03
R1985:Ly9 UTSW 1 171599773 missense probably damaging 1.00
R2219:Ly9 UTSW 1 171597681 splice site probably null
R2427:Ly9 UTSW 1 171607232 missense probably damaging 0.99
R3764:Ly9 UTSW 1 171594144 missense possibly damaging 0.92
R3815:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3816:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3817:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3819:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R4590:Ly9 UTSW 1 171593875 nonsense probably null
R4653:Ly9 UTSW 1 171594029 missense probably benign 0.41
R4755:Ly9 UTSW 1 171607238 missense probably damaging 0.99
R4871:Ly9 UTSW 1 171607330 intron probably benign
R5167:Ly9 UTSW 1 171605205 missense probably damaging 1.00
R5203:Ly9 UTSW 1 171599779 missense probably damaging 1.00
R5270:Ly9 UTSW 1 171601162 missense probably damaging 0.99
R5692:Ly9 UTSW 1 171605187 frame shift probably null
R5996:Ly9 UTSW 1 171601828 missense probably damaging 1.00
R6391:Ly9 UTSW 1 171601008 missense possibly damaging 0.76
R6457:Ly9 UTSW 1 171589095 missense probably damaging 1.00
R6730:Ly9 UTSW 1 171605169 missense probably benign 0.14
R6732:Ly9 UTSW 1 171594085 missense possibly damaging 0.74
R6862:Ly9 UTSW 1 171601155 missense probably benign 0.21
R6866:Ly9 UTSW 1 171605279 missense probably damaging 0.99
R7455:Ly9 UTSW 1 171593939 nonsense probably null
R8105:Ly9 UTSW 1 171605322 splice site probably null
R8349:Ly9 UTSW 1 171594018 missense probably damaging 0.99
R8449:Ly9 UTSW 1 171594018 missense probably damaging 0.99
X0062:Ly9 UTSW 1 171605221 missense possibly damaging 0.82
Z1176:Ly9 UTSW 1 171594060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACTACTTTCTTCCAGCATACTG -3'
(R):5'- TGGGCTCTGGATACTGCTTC -3'

Sequencing Primer
(F):5'- CAGGTATGTGGGTCCCCTAAATAC -3'
(R):5'- GGATACTGCTTCCCTTGGC -3'
Posted On2018-05-04