Incidental Mutation 'R6389:Olfr1197'
ID515669
Institutional Source Beutler Lab
Gene Symbol Olfr1197
Ensembl Gene ENSMUSG00000075119
Gene Nameolfactory receptor 1197
SynonymsMOR225-10P, GA_x6K02T2Q125-50202854-50201910, MOR225-14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88726903-88732366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88728672 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 309 (V309A)
Ref Sequence ENSEMBL: ENSMUSP00000150290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099815] [ENSMUST00000213118]
Predicted Effect probably benign
Transcript: ENSMUST00000099815
AA Change: V309A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097403
Gene: ENSMUSG00000075119
AA Change: V309A

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 1.3e-45 PFAM
Pfam:7tm_1 39 285 7.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213118
AA Change: V309A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Olfr1197
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1197 APN 2 88729065 missense probably damaging 1.00
IGL01515:Olfr1197 APN 2 88729008 missense probably benign
IGL01822:Olfr1197 APN 2 88728792 missense probably benign 0.03
IGL02060:Olfr1197 APN 2 88729563 missense probably damaging 0.98
IGL02466:Olfr1197 APN 2 88729395 missense probably damaging 1.00
IGL02698:Olfr1197 APN 2 88729471 missense probably damaging 1.00
R0336:Olfr1197 UTSW 2 88729154 missense possibly damaging 0.47
R1037:Olfr1197 UTSW 2 88729032 missense probably damaging 1.00
R1120:Olfr1197 UTSW 2 88728937 missense probably damaging 1.00
R1674:Olfr1197 UTSW 2 88729257 missense probably damaging 0.99
R1801:Olfr1197 UTSW 2 88729264 missense probably damaging 1.00
R1860:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R1861:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R2049:Olfr1197 UTSW 2 88728745 missense probably damaging 1.00
R2308:Olfr1197 UTSW 2 88729084 missense probably damaging 0.97
R2411:Olfr1197 UTSW 2 88729397 missense probably benign 0.06
R4707:Olfr1197 UTSW 2 88728712 missense possibly damaging 0.62
R5000:Olfr1197 UTSW 2 88729566 missense probably damaging 0.96
R5157:Olfr1197 UTSW 2 88729548 missense probably benign
R6000:Olfr1197 UTSW 2 88729231 missense probably damaging 1.00
R6021:Olfr1197 UTSW 2 88728950 nonsense probably null
R6636:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6637:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6979:Olfr1197 UTSW 2 88729184 missense probably benign 0.03
R7618:Olfr1197 UTSW 2 88728836 nonsense probably null
R8382:Olfr1197 UTSW 2 88729513 missense probably damaging 0.98
X0020:Olfr1197 UTSW 2 88729381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAATCTTGCAGCCTTTCG -3'
(R):5'- GCAAAGCACTCTCTACCTGTAG -3'

Sequencing Primer
(F):5'- GCAGCCTTTCGATCCACCTG -3'
(R):5'- CTCTACCTGTAGTTCACACATAATGG -3'
Posted On2018-05-04