Mutagenetix > Incidental Mutations

Incidental Mutation 'R6389:Ubr1'

515672

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.733) question?

Stock #

R6389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 120881039 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1458 (T1458K)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

Predicted Effect

probably benign
Transcript: ENSMUST00000028728
AA Change: T1458K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: T1458K

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135891

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406B18Rik	A	C	7: 43,497,830	L326R	possibly damaging	Het
5430403G16Rik	G	A	5: 109,676,019	P522S	possibly damaging	Het
Abcb11	A	T	2: 69,323,894	N109K	probably damaging	Het
Actn1	T	A	12: 80,174,522	M586L	probably benign	Het
Ago4	T	A	4: 126,507,244	I603F	probably damaging	Het
Bicc1	A	T	10: 70,958,922	V135D	probably damaging	Het
Bms1	T	C	6: 118,403,235	N704D	possibly damaging	Het
Cadm4	A	C	7: 24,499,534	Q78P	probably benign	Het
Ccdc114	G	T	7: 45,948,516	V617F	probably benign	Het
Cfap74	T	C	4: 155,423,336	I248T	possibly damaging	Het
Clu	G	C	14: 65,971,322		probably benign	Het
Cnnm3	T	C	1: 36,520,522	V514A	probably damaging	Het
Cntd1	A	T	11: 101,285,751	I225F	probably damaging	Het
Col20a1	T	C	2: 180,992,583		probably null	Het
Ctnnal1	A	G	4: 56,813,849	V640A	probably benign	Het
Cul4a	A	G	8: 13,140,278	T572A	probably benign	Het
D16Ertd472e	A	G	16: 78,545,183	S270P	probably damaging	Het
Dmp1	A	T	5: 104,212,922	N488I	probably damaging	Het
Dnah14	G	A	1: 181,651,202		probably null	Het
Dst	T	C	1: 34,193,184	L3464P	probably damaging	Het
Fnbp4	C	T	2: 90,745,535	P27S	unknown	Het
Fpr-rs3	A	T	17: 20,623,968	F304I	probably damaging	Het
Gm13941	T	C	2: 111,098,389	Q108R	unknown	Het
Hcn3	C	T	3: 89,150,933	A339T	possibly damaging	Het
Inpp5f	A	G	7: 128,678,056	D460G	probably damaging	Het
Ism2	T	C	12: 87,282,371	E253G	possibly damaging	Het
Klrg1	T	C	6: 122,271,472	N156S	probably damaging	Het
Ksr2	A	G	5: 117,414,842	N5S	probably benign	Het
Lrrc7	T	G	3: 158,185,426	E368A	probably damaging	Het
Ly9	G	C	1: 171,596,537	S482C	probably damaging	Het
Map3k1	T	C	13: 111,769,441	D289G	probably damaging	Het
Mcub	T	C	3: 129,918,708	T173A	probably benign	Het
Mup16	T	C	4: 61,518,940	E48G	probably damaging	Het
Naf1	C	T	8: 66,861,028	S24L	possibly damaging	Het
Ncoa6	A	G	2: 155,395,816	S2024P	probably damaging	Het
Nop56	C	A	2: 130,277,887	Q83K	probably damaging	Het
Nt5e	T	C	9: 88,363,471	Y265H	probably damaging	Het
Olfr1151	C	T	2: 87,858,023	P283S	probably damaging	Het
Olfr1197	A	G	2: 88,728,672	V309A	probably benign	Het
Olfr551	A	T	7: 102,588,472	N90K	probably benign	Het
Oxct2a	T	A	4: 123,323,427	K54*	probably null	Het
Oxct2b	G	T	4: 123,116,574	D96Y	probably benign	Het
Pisd	A	G	5: 32,764,847	Y250H	probably damaging	Het
Plekhm1	G	T	11: 103,366,894	N1071K	probably benign	Het
Prr11	G	A	11: 87,098,738	T269I	possibly damaging	Het
Ptpn4	T	A	1: 119,721,954	H304L	probably damaging	Het
Rrp1b	A	G	17: 32,056,627	K383E	possibly damaging	Het
Sel1l2	C	A	2: 140,245,354	A466S	probably damaging	Het
Slc9a4	A	G	1: 40,580,684	I57V	probably benign	Het
Spag9	A	G	11: 94,086,311	E81G	probably damaging	Het
Tbr1	A	G	2: 61,806,287		probably benign	Het
Tnrc6c	A	G	11: 117,722,741	D735G	probably damaging	Het
Tspan17	A	T	13: 54,795,616		probably null	Het
Tyw5	T	C	1: 57,391,499	K175R	probably damaging	Het
Ube2o	A	C	11: 116,548,858	I162R	probably null	Het
Vmn2r16	A	T	5: 109,330,478	Q33L	probably benign	Het
Zfp799	A	G	17: 32,820,578	L238P	probably damaging	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	synonymous	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	intron	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	not run

Predicted Primers

PCR Primer
(F):5'- ACCTACATATCTGGAAAGTAGCTGG -3'
(R):5'- GTGGCCTTTCTCAGTTAACCTG -3'

Sequencing Primer
(F):5'- TTGAGCTAATTACCCTTTCACAAC -3'
(R):5'- AGTTAACCTGTTGCTGTCCATTC -3'

Posted On

2018-05-04