Incidental Mutation 'R6389:Sel1l2'
ID515674
Institutional Source Beutler Lab
Gene Symbol Sel1l2
Ensembl Gene ENSMUSG00000074764
Gene Namesel-1 suppressor of lin-12-like 2 (C. elegans)
SynonymsLOC228684
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location140229855-140389706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140245354 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 466 (A466S)
Ref Sequence ENSEMBL: ENSMUSP00000113800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122367]
Predicted Effect probably damaging
Transcript: ENSMUST00000122367
AA Change: A466S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113800
Gene: ENSMUSG00000074764
AA Change: A466S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 70 83 N/A INTRINSIC
SEL1 107 142 1.99e2 SMART
SEL1 143 178 3.3e1 SMART
SEL1 179 214 5.7e-1 SMART
SEL1 215 250 6.3e-3 SMART
SEL1 297 333 6.59e-6 SMART
SEL1 334 370 1.32e-5 SMART
SEL1 371 406 4.55e-9 SMART
SEL1 407 442 4.02e-10 SMART
SEL1 443 478 2.72e-7 SMART
Blast:SEL1 511 550 9e-13 BLAST
SEL1 551 586 1.01e-6 SMART
SEL1 588 623 4.55e-9 SMART
transmembrane domain 661 683 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Sel1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Sel1l2 APN 2 140243944 missense possibly damaging 0.95
IGL01782:Sel1l2 APN 2 140243935 missense probably damaging 1.00
IGL02238:Sel1l2 APN 2 140247939 missense probably damaging 1.00
IGL02506:Sel1l2 APN 2 140275460 missense possibly damaging 0.89
IGL02539:Sel1l2 APN 2 140230858 missense probably damaging 1.00
IGL02999:Sel1l2 APN 2 140230804 missense probably damaging 1.00
IGL03388:Sel1l2 APN 2 140263364 splice site probably benign
IGL02988:Sel1l2 UTSW 2 140248588 missense probably damaging 1.00
R0386:Sel1l2 UTSW 2 140275441 missense probably benign 0.11
R0426:Sel1l2 UTSW 2 140240912 nonsense probably null
R0549:Sel1l2 UTSW 2 140265882 missense probably damaging 0.99
R1404:Sel1l2 UTSW 2 140230059 splice site probably benign
R1502:Sel1l2 UTSW 2 140389595 missense probably damaging 0.99
R1746:Sel1l2 UTSW 2 140285237 missense probably damaging 0.98
R2187:Sel1l2 UTSW 2 140230873 missense probably damaging 1.00
R2233:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R2235:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R3402:Sel1l2 UTSW 2 140241038 missense probably damaging 1.00
R4717:Sel1l2 UTSW 2 140230023 missense possibly damaging 0.89
R4724:Sel1l2 UTSW 2 140240927 missense probably damaging 0.99
R4840:Sel1l2 UTSW 2 140263470 missense probably benign 0.00
R4948:Sel1l2 UTSW 2 140244166 missense probably damaging 1.00
R6008:Sel1l2 UTSW 2 140244105 missense probably damaging 1.00
R6058:Sel1l2 UTSW 2 140240969 missense possibly damaging 0.94
R7031:Sel1l2 UTSW 2 140340123 missense possibly damaging 0.84
R7056:Sel1l2 UTSW 2 140245414 missense probably benign 0.13
R7074:Sel1l2 UTSW 2 140263442 missense probably damaging 1.00
R7213:Sel1l2 UTSW 2 140244135 missense probably damaging 1.00
R7348:Sel1l2 UTSW 2 140265724 missense probably benign
R8030:Sel1l2 UTSW 2 140241018 missense probably damaging 0.97
R8100:Sel1l2 UTSW 2 140275409 missense probably damaging 1.00
R8165:Sel1l2 UTSW 2 140262706 missense probably damaging 1.00
R8201:Sel1l2 UTSW 2 140266392 missense probably damaging 1.00
R8343:Sel1l2 UTSW 2 140230833 missense probably benign 0.03
X0019:Sel1l2 UTSW 2 140248615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGAAAGAGTCATTTCTAGCCTTC -3'
(R):5'- GCAGTTTGTCTCACGCCTTG -3'

Sequencing Primer
(F):5'- AAAGAGTCATTTCTAGCCTTCTCTTC -3'
(R):5'- CCTGTTCAGACTAGTGGATATCAC -3'
Posted On2018-05-04