Incidental Mutation 'R6389:Oxct2a'
ID515683
Institutional Source Beutler Lab
Gene Symbol Oxct2a
Ensembl Gene ENSMUSG00000076436
Gene Name3-oxoacid CoA transferase 2A
SynonymsOxct2, Scot-t1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location123321875-123323634 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 123323427 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 54 (K54*)
Ref Sequence ENSEMBL: ENSMUSP00000099700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040496] [ENSMUST00000102640] [ENSMUST00000102641]
Predicted Effect probably benign
Transcript: ENSMUST00000040496
SMART Domains Protein: ENSMUSP00000037779
Gene: ENSMUSG00000032726

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 27 248 3.1e-67 PFAM
low complexity region 250 271 N/A INTRINSIC
TGFB 298 412 2.18e-60 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102640
AA Change: K54*
SMART Domains Protein: ENSMUSP00000099700
Gene: ENSMUSG00000076436
AA Change: K54*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
CoA_trans 43 272 2.17e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102641
SMART Domains Protein: ENSMUSP00000099701
Gene: ENSMUSG00000032726

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 11 248 2e-57 PFAM
low complexity region 250 271 N/A INTRINSIC
TGFB 298 399 2e-68 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Oxct2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Oxct2a APN 4 123323390 missense possibly damaging 0.95
IGL03256:Oxct2a APN 4 123322965 missense probably damaging 1.00
PIT4403001:Oxct2a UTSW 4 123322444 missense probably damaging 1.00
R1743:Oxct2a UTSW 4 123323516 missense possibly damaging 0.96
R3834:Oxct2a UTSW 4 123322473 missense probably benign
R4659:Oxct2a UTSW 4 123322680 missense probably benign 0.20
R4690:Oxct2a UTSW 4 123323043 missense probably benign 0.08
R4932:Oxct2a UTSW 4 123322703 missense probably benign
R4954:Oxct2a UTSW 4 123322459 nonsense probably null
R5253:Oxct2a UTSW 4 123323093 missense probably damaging 1.00
R5426:Oxct2a UTSW 4 123322713 missense possibly damaging 0.93
R6611:Oxct2a UTSW 4 123322847 missense probably damaging 1.00
R7196:Oxct2a UTSW 4 123323372 missense probably damaging 1.00
R7617:Oxct2a UTSW 4 123323357 missense probably damaging 1.00
Z1176:Oxct2a UTSW 4 123322538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTTAGAGTAATCAGGTGGCC -3'
(R):5'- AGGTGAACCTGGCCTTTCTC -3'

Sequencing Primer
(F):5'- TGCACCAGCGTTCCATAG -3'
(R):5'- TCTCTGTCCCGGAGCTG -3'
Posted On2018-05-04