Incidental Mutation 'R6389:Pisd'
ID515686
Institutional Source Beutler Lab
Gene Symbol Pisd
Ensembl Gene ENSMUSG00000023452
Gene Namephosphatidylserine decarboxylase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32736301-32785646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32764847 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 250 (Y250H)
Ref Sequence ENSEMBL: ENSMUSP00000124923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061895] [ENSMUST00000142957] [ENSMUST00000144673]
Predicted Effect probably damaging
Transcript: ENSMUST00000061895
AA Change: Y80H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051438
Gene: ENSMUSG00000023452
AA Change: Y80H

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 162 405 1.1e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138360
Predicted Effect unknown
Transcript: ENSMUST00000142779
AA Change: Y70H
SMART Domains Protein: ENSMUSP00000122705
Gene: ENSMUSG00000023452
AA Change: Y70H

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 153 270 1.7e-33 PFAM
Pfam:PS_Dcarbxylase 268 358 2.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142957
AA Change: V56A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000144673
AA Change: Y250H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574
AA Change: Y250H

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145759
Meta Mutation Damage Score 0.1253 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylserine to phosphatidylethanolamine in the inner mitochondrial membrane. The encoded protein is active in phospholipid metabolism and interorganelle trafficking of phosphatidylserine. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryogenesis defects such as abnormal trophoblast development, abnormal extraembronic tissue morphology and abnormal mitochondrial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Pisd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pisd APN 5 32738412 missense probably benign 0.02
IGL00540:Pisd APN 5 32738412 missense probably benign 0.02
IGL00577:Pisd APN 5 32738412 missense probably benign 0.02
IGL00580:Pisd APN 5 32738412 missense probably benign 0.02
IGL00590:Pisd APN 5 32738412 missense probably benign 0.02
IGL00990:Pisd APN 5 32739358 missense probably benign 0.24
IGL01899:Pisd APN 5 32739132 splice site probably null
IGL01908:Pisd APN 5 32739132 splice site probably null
IGL01928:Pisd APN 5 32739132 splice site probably null
IGL01931:Pisd APN 5 32739132 splice site probably null
IGL01935:Pisd APN 5 32739132 splice site probably null
IGL01948:Pisd APN 5 32739132 splice site probably null
IGL01952:Pisd APN 5 32739132 splice site probably null
IGL02195:Pisd APN 5 32737315 missense probably damaging 1.00
shandong UTSW 5 32764796 missense possibly damaging 0.94
R0674:Pisd UTSW 5 32774437 missense probably benign 0.00
R0840:Pisd UTSW 5 32737312 missense probably damaging 1.00
R1976:Pisd UTSW 5 32738865 missense probably damaging 1.00
R1986:Pisd UTSW 5 32737328 missense probably damaging 1.00
R2044:Pisd UTSW 5 32764796 missense possibly damaging 0.94
R5705:Pisd UTSW 5 32737363 missense probably benign 0.14
R5756:Pisd UTSW 5 32738498 missense probably damaging 1.00
R6249:Pisd UTSW 5 32738844 missense probably damaging 1.00
R6913:Pisd UTSW 5 32737429 missense probably damaging 1.00
R7143:Pisd UTSW 5 32738502 missense possibly damaging 0.73
R7571:Pisd UTSW 5 32737337 missense probably damaging 1.00
R7626:Pisd UTSW 5 32740688 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGTGATTCCTACAGCCACC -3'
(R):5'- TAAGGTCGTCTTTCGGGCTC -3'

Sequencing Primer
(F):5'- GTGATTCCTACAGCCACCCAAAATTC -3'
(R):5'- GTGGTACTGGGATTGCATGAC -3'
Posted On2018-05-04