Incidental Mutation 'R6389:Dmp1'
ID515687
Institutional Source Beutler Lab
Gene Symbol Dmp1
Ensembl Gene ENSMUSG00000029307
Gene Namedentin matrix protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104202613-104214102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104212922 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 488 (N488I)
Ref Sequence ENSEMBL: ENSMUSP00000068053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066708]
Predicted Effect probably damaging
Transcript: ENSMUST00000066708
AA Change: N488I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068053
Gene: ENSMUSG00000029307
AA Change: N488I

DomainStartEndE-ValueType
Pfam:DMP1 1 503 9.8e-206 PFAM
Meta Mutation Damage Score 0.6816 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypophosphatemia, rickets, osteomalacia, renal phosphate-wasting, impaired osteocyte maturation, defective dentinogenesis, and severe alveolar bone and cementum defects leading to early periodontal breakdown. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Dmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dmp1 APN 5 104210155 splice site probably benign
IGL01063:Dmp1 APN 5 104207099 start codon destroyed probably null 0.73
IGL01599:Dmp1 APN 5 104212462 nonsense probably null
IGL01631:Dmp1 APN 5 104212868 missense probably benign 0.04
IGL01646:Dmp1 APN 5 104211865 missense probably damaging 1.00
IGL02611:Dmp1 APN 5 104212514 missense probably damaging 1.00
IGL02642:Dmp1 APN 5 104211670 missense probably damaging 0.97
choppers UTSW 5 104207125 missense probably damaging 1.00
R0197:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R0494:Dmp1 UTSW 5 104212208 missense probably damaging 1.00
R0529:Dmp1 UTSW 5 104212226 missense probably benign 0.03
R0850:Dmp1 UTSW 5 104212787 missense possibly damaging 0.86
R0883:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R1858:Dmp1 UTSW 5 104207630 missense possibly damaging 0.92
R1869:Dmp1 UTSW 5 104212076 missense probably damaging 1.00
R1995:Dmp1 UTSW 5 104209913 missense possibly damaging 0.60
R2004:Dmp1 UTSW 5 104211924 missense possibly damaging 0.73
R2009:Dmp1 UTSW 5 104212840 missense probably damaging 0.97
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R4716:Dmp1 UTSW 5 104212561 missense probably damaging 0.99
R5687:Dmp1 UTSW 5 104207086 start gained probably benign
R6331:Dmp1 UTSW 5 104207125 missense probably damaging 1.00
R7006:Dmp1 UTSW 5 104212322 missense probably benign 0.02
R7103:Dmp1 UTSW 5 104211863 missense probably damaging 1.00
R7699:Dmp1 UTSW 5 104211724 missense probably damaging 1.00
R8181:Dmp1 UTSW 5 104211514 splice site probably null
R8350:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
R8379:Dmp1 UTSW 5 104211705 nonsense probably null
R8450:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
Z1177:Dmp1 UTSW 5 104211652 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCTGAACACATTCTCCAGC -3'
(R):5'- TCCAACAGTTCCTCACAGGG -3'

Sequencing Primer
(F):5'- TCTCCGAGGAGAGTCAGGAGTC -3'
(R):5'- CAGTTCCTCACAGGGGGAAAAC -3'
Posted On2018-05-04