Incidental Mutation 'R6389:Cadm4'
ID515692
Institutional Source Beutler Lab
Gene Symbol Cadm4
Ensembl Gene ENSMUSG00000054793
Gene Namecell adhesion molecule 4
SynonymsNecl-4, Tsll2, SynCAM 4, Igsf4c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24482023-24504539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24499534 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 78 (Q78P)
Ref Sequence ENSEMBL: ENSMUSP00000066880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068023]
Predicted Effect probably benign
Transcript: ENSMUST00000068023
AA Change: Q78P

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066880
Gene: ENSMUSG00000054793
AA Change: Q78P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 29 121 3.18e-6 SMART
IG 130 221 7.89e-2 SMART
IGc2 236 298 1.54e-13 SMART
4.1m 344 362 3.37e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205820
Meta Mutation Damage Score 0.5041 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele do not display myelination abnormalities. Mice with ubiquitous conditional deletion of the gene show myelination abnormalities, decreased nerve conduction velocity, hindlimb rigidity, limb grasping, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Cadm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Cadm4 APN 7 24502759 missense possibly damaging 0.56
IGL01369:Cadm4 APN 7 24499522 missense possibly damaging 0.50
IGL02134:Cadm4 APN 7 24499561 missense probably benign 0.00
IGL03037:Cadm4 APN 7 24500795 missense probably damaging 1.00
IGL03086:Cadm4 APN 7 24500815 missense probably damaging 0.96
R0024:Cadm4 UTSW 7 24502744 missense probably benign 0.28
R1444:Cadm4 UTSW 7 24503621 makesense probably null
R6177:Cadm4 UTSW 7 24502761 missense possibly damaging 0.95
R7143:Cadm4 UTSW 7 24499567 missense possibly damaging 0.85
R7822:Cadm4 UTSW 7 24503545 missense possibly damaging 0.62
R8134:Cadm4 UTSW 7 24503605 missense possibly damaging 0.85
X0026:Cadm4 UTSW 7 24499924 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGGACTGGAAGTCTGGACTC -3'
(R):5'- CGAACAGGTCTCAGGACAAGTG -3'

Sequencing Primer
(F):5'- AAGTCTGGACTCCCATGGTC -3'
(R):5'- TGTAGAGCTGGCAGAAGT -3'
Posted On2018-05-04