Incidental Mutation 'R6389:Cul4a'
ID515697
Institutional Source Beutler Lab
Gene Symbol Cul4a
Ensembl Gene ENSMUSG00000031446
Gene Namecullin 4A
Synonyms2810470J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.618) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13105621-13147940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13140278 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 572 (T572A)
Ref Sequence ENSEMBL: ENSMUSP00000016680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016680] [ENSMUST00000125514]
Predicted Effect probably benign
Transcript: ENSMUST00000016680
AA Change: T572A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016680
Gene: ENSMUSG00000031446
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 20 39 N/A INTRINSIC
SCOP:d1ldja2 61 401 1e-118 SMART
Blast:CULLIN 83 151 5e-9 BLAST
CULLIN 434 582 1.6e-76 SMART
Blast:CULLIN 585 640 7e-28 BLAST
Cullin_Nedd8 688 753 8.29e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125514
SMART Domains Protein: ENSMUSP00000123074
Gene: ENSMUSG00000031446

DomainStartEndE-ValueType
Pfam:Cullin 1 68 5.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185110
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CUL4A is the ubiquitin ligase component of a multimeric complex involved in the degradation of DNA damage-response proteins (Liu et al., 2009 [PubMed 19481525]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit reduced female fertility, male infertility, impaired spermatogenesis, and impaired DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Cul4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Cul4a APN 8 13127735 missense probably benign 0.18
IGL00952:Cul4a APN 8 13146562 missense probably damaging 1.00
IGL01604:Cul4a APN 8 13133843 critical splice donor site probably null
IGL01688:Cul4a APN 8 13146571 nonsense probably null
IGL02167:Cul4a APN 8 13122826 missense probably damaging 1.00
IGL02927:Cul4a APN 8 13124861 missense possibly damaging 0.55
IGL03066:Cul4a APN 8 13133776 missense probably benign 0.22
R0183:Cul4a UTSW 8 13133790 missense probably damaging 0.98
R1600:Cul4a UTSW 8 13123954 missense probably damaging 1.00
R1860:Cul4a UTSW 8 13123565 missense probably damaging 1.00
R1865:Cul4a UTSW 8 13142589 missense possibly damaging 0.94
R1905:Cul4a UTSW 8 13133171 missense probably benign 0.06
R1964:Cul4a UTSW 8 13136406 missense possibly damaging 0.62
R1964:Cul4a UTSW 8 13136854 missense probably benign 0.00
R2381:Cul4a UTSW 8 13136887 missense probably benign 0.45
R3787:Cul4a UTSW 8 13133668 missense probably damaging 0.99
R4006:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4007:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4748:Cul4a UTSW 8 13123526 missense probably benign 0.06
R5244:Cul4a UTSW 8 13146566 missense probably damaging 1.00
R6736:Cul4a UTSW 8 13136219 missense probably benign 0.00
R7201:Cul4a UTSW 8 13142991 missense probably damaging 0.98
R7313:Cul4a UTSW 8 13121676 critical splice acceptor site probably benign
R7446:Cul4a UTSW 8 13136874 missense probably benign
R7485:Cul4a UTSW 8 13140279 missense possibly damaging 0.68
R7569:Cul4a UTSW 8 13123493 missense probably benign
R8219:Cul4a UTSW 8 13146540 missense possibly damaging 0.91
R8304:Cul4a UTSW 8 13127727 missense possibly damaging 0.88
X0026:Cul4a UTSW 8 13105871 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTCTGTCCCTAGCAGTAGGTGAAAG -3'
(R):5'- ATTGACCAAGAAAAGCTACTGC -3'

Sequencing Primer
(F):5'- TCAGTCTCAGAGATTGTAGCCCAAG -3'
(R):5'- TCTGCCAGAAAGGAAGAAAC -3'
Posted On2018-05-04