Incidental Mutation 'R6389:Ube2o'
ID515706
Institutional Source Beutler Lab
Gene Symbol Ube2o
Ensembl Gene ENSMUSG00000020802
Gene Nameubiquitin-conjugating enzyme E2O
SynonymsB230113M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116537740-116581447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 116548858 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 162 (I162R)
Ref Sequence ENSEMBL: ENSMUSP00000080791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082152]
Predicted Effect probably null
Transcript: ENSMUST00000082152
AA Change: I162R

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080791
Gene: ENSMUSG00000020802
AA Change: I162R

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 470 505 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 705 712 N/A INTRINSIC
low complexity region 715 737 N/A INTRINSIC
coiled coil region 845 879 N/A INTRINSIC
UBCc 953 1110 2.23e-16 SMART
Blast:UBCc 1201 1274 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147851
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased MEF proliferation and transformation and increased pre-weaning lethality. Mice heterozygous for the allele exhibit increased total body fat amount, increased startle reflex, increased grip strength and increased circulating HDL cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Ube2o
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ube2o APN 11 116544754 missense probably benign
IGL00973:Ube2o APN 11 116541205 missense probably damaging 1.00
IGL01291:Ube2o APN 11 116540134 missense probably damaging 1.00
IGL01804:Ube2o APN 11 116544373 missense probably benign 0.03
IGL02138:Ube2o APN 11 116543400 splice site probably benign
IGL02317:Ube2o APN 11 116541563 missense probably damaging 1.00
IGL02515:Ube2o APN 11 116543699 missense probably damaging 1.00
IGL02535:Ube2o APN 11 116541765 missense probably benign 0.00
IGL03062:Ube2o APN 11 116541642 missense probably damaging 0.99
IGL03145:Ube2o APN 11 116544009 missense probably damaging 1.00
IGL03190:Ube2o APN 11 116545128 missense probably damaging 1.00
Delay UTSW 11 116540072 missense probably damaging 1.00
Tarry UTSW 11 116541368 missense probably damaging 1.00
ANU05:Ube2o UTSW 11 116540134 missense probably damaging 1.00
R0519:Ube2o UTSW 11 116546459 critical splice donor site probably null
R0666:Ube2o UTSW 11 116542835 missense probably damaging 1.00
R1056:Ube2o UTSW 11 116546464 missense probably damaging 1.00
R1202:Ube2o UTSW 11 116541582 missense probably damaging 1.00
R1424:Ube2o UTSW 11 116543732 missense probably benign
R1469:Ube2o UTSW 11 116545824 splice site probably benign
R1720:Ube2o UTSW 11 116544607 missense probably benign
R1791:Ube2o UTSW 11 116541494 missense probably benign 0.01
R1893:Ube2o UTSW 11 116548835 missense possibly damaging 0.68
R1997:Ube2o UTSW 11 116545337 missense probably damaging 0.99
R2156:Ube2o UTSW 11 116581146 missense probably damaging 0.98
R2199:Ube2o UTSW 11 116544745 missense probably benign
R2414:Ube2o UTSW 11 116548857 missense probably benign 0.02
R3766:Ube2o UTSW 11 116546863 splice site probably benign
R4749:Ube2o UTSW 11 116541908 missense probably benign 0.11
R5213:Ube2o UTSW 11 116541459 missense possibly damaging 0.82
R5403:Ube2o UTSW 11 116548807 missense possibly damaging 0.48
R5441:Ube2o UTSW 11 116544442 missense probably damaging 1.00
R5727:Ube2o UTSW 11 116539670 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116541378 missense probably damaging 1.00
R6125:Ube2o UTSW 11 116544750 missense possibly damaging 0.50
R6234:Ube2o UTSW 11 116539490 missense probably benign 0.17
R6278:Ube2o UTSW 11 116539543 missense probably damaging 1.00
R6324:Ube2o UTSW 11 116539359 missense probably benign 0.00
R6346:Ube2o UTSW 11 116541368 missense probably damaging 1.00
R7040:Ube2o UTSW 11 116541860 missense probably benign 0.08
R7072:Ube2o UTSW 11 116541501 missense probably benign 0.13
R7270:Ube2o UTSW 11 116543935 missense possibly damaging 0.62
R7420:Ube2o UTSW 11 116540072 missense probably damaging 1.00
R7593:Ube2o UTSW 11 116581079 missense possibly damaging 0.73
R7818:Ube2o UTSW 11 116543910 missense probably damaging 1.00
R7916:Ube2o UTSW 11 116581058 missense probably benign
R8212:Ube2o UTSW 11 116548798 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TCTAGTAGCGCACAGGCAAG -3'
(R):5'- ACACATGCGCTCAACTGTG -3'

Sequencing Primer
(F):5'- TGGCCACAGTGACCAAGC -3'
(R):5'- AACTGTGAGTCCCTCATCCC -3'
Posted On2018-05-04