Incidental Mutation 'R6389:D16Ertd472e'
ID515712
Institutional Source Beutler Lab
Gene Symbol D16Ertd472e
Ensembl Gene ENSMUSG00000022864
Gene NameDNA segment, Chr 16, ERATO Doi 472, expressed
Synonyms2310009O17Rik, E330003K22Rik, 1700010I10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_025967.3

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location78540338-78576708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78545183 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 270 (S270P)
Ref Sequence ENSEMBL: ENSMUSP00000156198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114218] [ENSMUST00000114219] [ENSMUST00000114220] [ENSMUST00000231272] [ENSMUST00000231973] [ENSMUST00000232052] [ENSMUST00000232528]
Predicted Effect probably damaging
Transcript: ENSMUST00000114218
AA Change: S270P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109856
Gene: ENSMUSG00000022864
AA Change: S270P

DomainStartEndE-ValueType
Pfam:EURL 1 284 2.6e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114219
AA Change: S270P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109857
Gene: ENSMUSG00000022864
AA Change: S270P

DomainStartEndE-ValueType
Pfam:EURL 1 284 1.7e-164 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114220
AA Change: S270P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109858
Gene: ENSMUSG00000022864
AA Change: S270P

DomainStartEndE-ValueType
Pfam:EURL 1 284 1.7e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231272
Predicted Effect probably damaging
Transcript: ENSMUST00000231973
AA Change: S270P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232052
AA Change: S270P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232329
Predicted Effect probably benign
Transcript: ENSMUST00000232528
Meta Mutation Damage Score 0.5812 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in D16Ertd472e
AlleleSourceChrCoordTypePredicted EffectPPH Score
F5426:D16Ertd472e UTSW 16 78548001 missense probably damaging 0.98
R0360:D16Ertd472e UTSW 16 78547885 missense probably benign 0.01
R1635:D16Ertd472e UTSW 16 78546504 critical splice donor site probably null
R2215:D16Ertd472e UTSW 16 78545267 missense probably benign 0.02
R4044:D16Ertd472e UTSW 16 78576006 missense probably damaging 1.00
R4657:D16Ertd472e UTSW 16 78547926 missense probably damaging 1.00
R4943:D16Ertd472e UTSW 16 78575989 missense probably damaging 1.00
R6170:D16Ertd472e UTSW 16 78545267 missense probably benign 0.02
R7208:D16Ertd472e UTSW 16 78575926 missense probably damaging 0.99
R7390:D16Ertd472e UTSW 16 78547688 missense probably benign 0.03
R7581:D16Ertd472e UTSW 16 78546557 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GTTTTGCAAGCACAACAACC -3'
(R):5'- TAGGCTCAGAAGGAAGCATTC -3'

Sequencing Primer
(F):5'- CATAAAAATGGACCATGACTTCCTTC -3'
(R):5'- AAATGACTTGATGCGTTGTCCC -3'
Posted On2018-05-04