Incidental Mutation 'R6389:Zfp799'
ID515715
Institutional Source Beutler Lab
Gene Symbol Zfp799
Ensembl Gene ENSMUSG00000095253
Gene Namezinc finger protein 799
Synonyms6030490I01Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177359.4; MGI:2443934

Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32815449-32830261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32820578 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 238 (L238P)
Ref Sequence ENSEMBL: ENSMUSP00000144480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179695] [ENSMUST00000201499] [ENSMUST00000201876] [ENSMUST00000202759] [ENSMUST00000202988]
Predicted Effect probably damaging
Transcript: ENSMUST00000179695
AA Change: L237P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136298
Gene: ENSMUSG00000095253
AA Change: L237P

DomainStartEndE-ValueType
KRAB 3 60 1.22e-9 SMART
low complexity region 97 110 N/A INTRINSIC
ZnF_C2H2 194 216 1.2e-3 SMART
ZnF_C2H2 222 244 1.28e-3 SMART
ZnF_C2H2 250 272 4.87e-4 SMART
ZnF_C2H2 278 300 9.08e-4 SMART
ZnF_C2H2 306 328 2.27e-4 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 360 382 4.34e-1 SMART
ZnF_C2H2 388 410 1.84e-4 SMART
ZnF_C2H2 416 438 9.58e-3 SMART
ZnF_C2H2 444 466 6.32e-3 SMART
ZnF_C2H2 472 494 2.95e-3 SMART
ZnF_C2H2 500 522 2.2e-2 SMART
ZnF_C2H2 528 550 1.56e-2 SMART
ZnF_C2H2 556 578 2.4e-3 SMART
ZnF_C2H2 584 606 2.53e-2 SMART
ZnF_C2H2 612 634 4.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181318
Predicted Effect probably benign
Transcript: ENSMUST00000201499
SMART Domains Protein: ENSMUSP00000143907
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201876
SMART Domains Protein: ENSMUSP00000144187
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 5.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202759
SMART Domains Protein: ENSMUSP00000144087
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 63 5.6e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202988
AA Change: L238P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144480
Gene: ENSMUSG00000095253
AA Change: L238P

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
low complexity region 98 111 N/A INTRINSIC
ZnF_C2H2 195 217 1.2e-3 SMART
ZnF_C2H2 223 245 1.28e-3 SMART
ZnF_C2H2 251 273 4.87e-4 SMART
ZnF_C2H2 279 301 9.08e-4 SMART
ZnF_C2H2 307 329 2.27e-4 SMART
ZnF_C2H2 335 357 1.53e-1 SMART
ZnF_C2H2 361 383 4.34e-1 SMART
ZnF_C2H2 389 411 1.84e-4 SMART
ZnF_C2H2 417 439 9.58e-3 SMART
ZnF_C2H2 445 467 6.32e-3 SMART
ZnF_C2H2 473 495 2.95e-3 SMART
ZnF_C2H2 501 523 2.2e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.4e-3 SMART
ZnF_C2H2 585 607 2.53e-2 SMART
ZnF_C2H2 613 635 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Other mutations in Zfp799
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Zfp799 APN 17 32821820 missense possibly damaging 0.73
P0016:Zfp799 UTSW 17 32819357 missense possibly damaging 0.79
R0116:Zfp799 UTSW 17 32821035 missense possibly damaging 0.96
R0326:Zfp799 UTSW 17 32820726 missense possibly damaging 0.73
R1487:Zfp799 UTSW 17 32820677 missense possibly damaging 0.85
R1863:Zfp799 UTSW 17 32819400 missense probably damaging 1.00
R1929:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R1983:Zfp799 UTSW 17 32822110 missense probably damaging 1.00
R2127:Zfp799 UTSW 17 32819498 missense possibly damaging 0.80
R2271:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R2697:Zfp799 UTSW 17 32820240 nonsense probably null
R5134:Zfp799 UTSW 17 32820441 missense probably damaging 1.00
R5613:Zfp799 UTSW 17 32819990 missense probably damaging 0.98
R5839:Zfp799 UTSW 17 32822112 missense probably null 0.99
R6414:Zfp799 UTSW 17 32820285 missense probably damaging 1.00
R6475:Zfp799 UTSW 17 32820846 missense probably damaging 0.99
R6593:Zfp799 UTSW 17 32819790 missense probably damaging 1.00
R7133:Zfp799 UTSW 17 32820236 missense probably benign 0.19
R7543:Zfp799 UTSW 17 32820560 missense probably benign 0.11
R7883:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7889:Zfp799 UTSW 17 32819499 nonsense probably null
R8090:Zfp799 UTSW 17 32820975 missense probably benign 0.04
Z1176:Zfp799 UTSW 17 32820216 nonsense probably null
Z1177:Zfp799 UTSW 17 32830219 start gained probably benign
Z1177:Zfp799 UTSW 17 32830221 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTAACGGAGCTGTGACTAGTG -3'
(R):5'- CCCATCCAGTCAGAACGATG -3'

Sequencing Primer
(F):5'- CTGTGACTAGTGAAGGCTTTACCAC -3'
(R):5'- CCATCCAGTCAGAACGATGGAAAG -3'
Posted On2018-05-04