Incidental Mutation 'R6390:Cdca8'
ID 515721
Institutional Source Beutler Lab
Gene Symbol Cdca8
Ensembl Gene ENSMUSG00000028873
Gene Name cell division cycle associated 8
Synonyms Borealin, D4Ertd421e, 4831429J16Rik, DasraB
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_026560.4; MGI:1196274
Essential gene? Essential (E-score: 1.000) question?
Stock # R6390 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 124918465-124939311 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124936375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 68 (M68T)
Ref Sequence ENSEMBL: ENSMUSP00000081319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030690] [ENSMUST00000084296] [ENSMUST00000094769] [ENSMUST00000165281]
AlphaFold Q8BHX3
Predicted Effect probably damaging
Transcript: ENSMUST00000030690
AA Change: M68T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030690
Gene: ENSMUSG00000028873
AA Change: M68T

DomainStartEndE-ValueType
Pfam:Nbl1_Borealin_N 20 76 1.9e-20 PFAM
low complexity region 109 139 N/A INTRINSIC
Pfam:Borealin 148 286 5.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084296
AA Change: M68T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081319
Gene: ENSMUSG00000028873
AA Change: M68T

DomainStartEndE-ValueType
Pfam:Nbl1_Borealin_N 19 77 2.7e-24 PFAM
low complexity region 109 139 N/A INTRINSIC
Pfam:Borealin 173 286 2.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147074
Predicted Effect probably damaging
Transcript: ENSMUST00000165281
AA Change: M68T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132145
Gene: ENSMUSG00000028873
AA Change: M68T

DomainStartEndE-ValueType
Pfam:Nbl1_Borealin_N 19 77 1.5e-25 PFAM
Meta Mutation Damage Score 0.3606 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
MGI Phenotype Strain: 3795253
Lethality: E3-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit early embryonic lethality due to mitotic defects associated with abnormal microtubule organization and mislocalization of the chromosomal passenger protein complex. Blastocysts fail to develop past E3.5 and undergo apoptosis by E5.5. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(2) Gene trapped(12)
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Cdca8
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0024:Cdca8 UTSW 4 124926664 critical splice donor site probably null
R0017:Cdca8 UTSW 4 124920375 missense probably benign 0.15
R0017:Cdca8 UTSW 4 124920375 missense probably benign 0.15
R0025:Cdca8 UTSW 4 124921254 missense possibly damaging 0.90
R1024:Cdca8 UTSW 4 124922005 missense probably benign 0.00
R4689:Cdca8 UTSW 4 124931103 missense probably damaging 1.00
R5077:Cdca8 UTSW 4 124926677 missense probably damaging 1.00
R5597:Cdca8 UTSW 4 124919000 missense probably damaging 1.00
R6319:Cdca8 UTSW 4 124921294 missense possibly damaging 0.81
R7818:Cdca8 UTSW 4 124926663 critical splice donor site probably null
R9100:Cdca8 UTSW 4 124936445 missense probably benign 0.25
R9605:Cdca8 UTSW 4 124936591 missense probably damaging 1.00
R9765:Cdca8 UTSW 4 124920329 missense probably benign 0.11
X0026:Cdca8 UTSW 4 124926703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATCTGAAGGGTAATTCATGCC -3'
(R):5'- TTCCTGAAGGACTTCGACCG -3'

Sequencing Primer
(F):5'- CTGAAGGGTAATTCATGCCTACTTC -3'
(R):5'- AAGGGGTGGATTCGCGTGATC -3'
Posted On 2018-05-04