Incidental Mutation 'R6390:Hibadh'
ID515724
Institutional Source Beutler Lab
Gene Symbol Hibadh
Ensembl Gene ENSMUSG00000029776
Gene Name3-hydroxyisobutyrate dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6390 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location52546228-52640389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52556489 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 214 (L214R)
Ref Sequence ENSEMBL: ENSMUSP00000031788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031788]
Predicted Effect probably damaging
Transcript: ENSMUST00000031788
AA Change: L214R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031788
Gene: ENSMUSG00000029776
AA Change: L214R

DomainStartEndE-ValueType
Pfam:2-Hacid_dh_C 19 154 4.6e-10 PFAM
Pfam:NAD_binding_2 38 200 1.3e-51 PFAM
Pfam:F420_oxidored 40 133 3.4e-7 PFAM
Pfam:NAD_binding_11 202 329 6.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204075
Meta Mutation Damage Score 0.8943 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial 3-hydroxyisobutyrate dehydrogenase enzyme. The encoded protein plays a critical role in the catabolism of L-valine by catalyzing the oxidation of 3-hydroxyisobutyrate to methylmalonate semialdehyde. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Hibadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Hibadh APN 6 52548889 missense possibly damaging 0.93
IGL03116:Hibadh APN 6 52548932 missense probably damaging 1.00
R0103:Hibadh UTSW 6 52557877 missense probably benign 0.25
R0103:Hibadh UTSW 6 52557877 missense probably benign 0.25
R0468:Hibadh UTSW 6 52557770 splice site probably benign
R0800:Hibadh UTSW 6 52556505 missense probably damaging 1.00
R1950:Hibadh UTSW 6 52556463 missense probably benign 0.10
R4379:Hibadh UTSW 6 52620042 missense probably damaging 0.98
R4614:Hibadh UTSW 6 52546930 missense possibly damaging 0.85
R4987:Hibadh UTSW 6 52622895 missense probably damaging 1.00
R5073:Hibadh UTSW 6 52620094 missense possibly damaging 0.90
R5074:Hibadh UTSW 6 52620094 missense possibly damaging 0.90
R5402:Hibadh UTSW 6 52546980 missense probably benign 0.32
R6575:Hibadh UTSW 6 52547028 missense probably damaging 1.00
R7360:Hibadh UTSW 6 52640212 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTCAACACGCTCCTGAAC -3'
(R):5'- CTAGGTTCTGCTGAGGACAGTG -3'

Sequencing Primer
(F):5'- CCAACTCATTTATTACCATGAACGTC -3'
(R):5'- GGATACATTCCCTTACCTCCAGGAG -3'
Posted On2018-05-04