Incidental Mutation 'R6390:Muc2'
ID 515728
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission
Accession Numbers

Genbank: BC034197; MGI: 1339364
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6390 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141690340-141754693 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 141752146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 230 (V230L)
Ref Sequence ENSEMBL: ENSMUSP00000026590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026590]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026590
AA Change: V230L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: V230L

DomainStartEndE-ValueType
C8 1 63 1.65e-11 SMART
VWC 120 188 5.48e-2 SMART
VWC 229 293 2.38e-11 SMART
Blast:VWD 299 363 4e-17 BLAST
CT 380 463 3.6e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187945
AA Change: V669L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense probably benign 0.35
kenny APN 7 nonsense
Winnie APN 7 141699460 missense probably damaging 1.00
IGL01303:Muc2 APN 7 141752395 missense probably benign
IGL01482:Muc2 APN 7 141754060 missense probably damaging 0.96
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense probably damaging 1.00
IGL02415:Muc2 APN 7 141751872 nonsense probably null
IGL02548:Muc2 APN 7 141751857 missense probably damaging 1.00
IGL02836:Muc2 APN 7 141746713 unclassified probably benign
IGL03196:Muc2 APN 7 141747630 missense probably damaging 0.97
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense probably damaging 1.00
Schlendrian UTSW 7 141695682 missense probably damaging 1.00
Seco UTSW 7 141698733 missense probably damaging 1.00
BB001:Muc2 UTSW 7 141695388 missense probably damaging 1.00
BB011:Muc2 UTSW 7 141695388 missense probably damaging 1.00
E0370:Muc2 UTSW 7 141696355 missense probably damaging 1.00
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense probably damaging 1.00
R0201:Muc2 UTSW 7 141699185 frame shift probably null
R0299:Muc2 UTSW 7 141752729 missense probably damaging 1.00
R0547:Muc2 UTSW 7 141699185 frame shift probably null
R0699:Muc2 UTSW 7 141752300 missense probably damaging 1.00
R0900:Muc2 UTSW 7 141699185 frame shift probably null
R1348:Muc2 UTSW 7 141699185 frame shift probably null
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1625:Muc2 UTSW 7 141697162 missense probably damaging 1.00
R2010:Muc2 UTSW 7 141700875 missense probably damaging 0.99
R2149:Muc2 UTSW 7 141699185 frame shift probably null
R2163:Muc2 UTSW 7 141699185 frame shift probably null
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 unclassified probably benign
R3112:Muc2 UTSW 7 141745488 unclassified probably benign
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense probably damaging 1.00
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 unclassified probably benign
R3974:Muc2 UTSW 7 141746804 unclassified probably benign
R3976:Muc2 UTSW 7 141746804 unclassified probably benign
R4327:Muc2 UTSW 7 141695334 missense probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense probably damaging 1.00
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4798:Muc2 UTSW 7 141754140 missense probably benign 0.01
R4900:Muc2 UTSW 7 141749543 missense probably benign 0.32
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense probably benign 0.00
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 unclassified probably benign
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141697250 splice site probably null
R5979:Muc2 UTSW 7 141751406 missense probably damaging 0.99
R6175:Muc2 UTSW 7 141696632 missense probably damaging 1.00
R6213:Muc2 UTSW 7 141751414 missense probably damaging 1.00
R6281:Muc2 UTSW 7 141752403 missense probably damaging 1.00
R6321:Muc2 UTSW 7 141700828 missense probably benign 0.28
R6485:Muc2 UTSW 7 141746736 unclassified probably benign
R6582:Muc2 UTSW 7 141696698 missense probably benign 0.00
R6683:Muc2 UTSW 7 141751477 missense probably benign 0.38
R6896:Muc2 UTSW 7 141752695 missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141698733 missense probably damaging 1.00
R6924:Muc2 UTSW 7 141697834 missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141751457 missense unknown
R7222:Muc2 UTSW 7 141704209 missense
R7251:Muc2 UTSW 7 141692722 missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141752744 missense
R7315:Muc2 UTSW 7 141690402 missense probably damaging 0.99
R7421:Muc2 UTSW 7 141748126 missense
R7556:Muc2 UTSW 7 141753702 missense
R7651:Muc2 UTSW 7 141704201 missense
R7710:Muc2 UTSW 7 141700883 missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141704393 missense
R7813:Muc2 UTSW 7 141696300 splice site probably null
R7843:Muc2 UTSW 7 141695419 missense probably benign 0.03
R7869:Muc2 UTSW 7 141749734 missense
R7924:Muc2 UTSW 7 141695388 missense probably damaging 1.00
R7993:Muc2 UTSW 7 141754436 missense
R8053:Muc2 UTSW 7 141698332 missense probably benign 0.01
R8068:Muc2 UTSW 7 141744685 missense
R8099:Muc2 UTSW 7 141745438 splice site probably null
R8192:Muc2 UTSW 7 141751478 missense
R8194:Muc2 UTSW 7 141704252 missense
R8545:Muc2 UTSW 7 141752393 missense unknown
R8701:Muc2 UTSW 7 141695607 missense probably damaging 1.00
R8883:Muc2 UTSW 7 141700900 missense probably damaging 0.98
R8894:Muc2 UTSW 7 141694515 missense probably damaging 1.00
R8905:Muc2 UTSW 7 141693400 missense probably benign 0.00
R9024:Muc2 UTSW 7 141701367 missense probably damaging 0.98
R9032:Muc2 UTSW 7 141700489 missense probably damaging 1.00
R9085:Muc2 UTSW 7 141700489 missense probably damaging 1.00
R9091:Muc2 UTSW 7 141704267 missense
R9104:Muc2 UTSW 7 141699655 missense probably damaging 1.00
R9114:Muc2 UTSW 7 141701414 nonsense probably null
R9270:Muc2 UTSW 7 141704267 missense
R9297:Muc2 UTSW 7 141749022 missense
R9325:Muc2 UTSW 7 141744822 missense
R9354:Muc2 UTSW 7 141753420 missense
R9386:Muc2 UTSW 7 141693146 missense probably damaging 1.00
R9529:Muc2 UTSW 7 141700884 missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141754505 missense probably damaging 1.00
R9583:Muc2 UTSW 7 141746822 missense
R9607:Muc2 UTSW 7 141751453 missense
R9646:Muc2 UTSW 7 141690400 missense probably benign
R9651:Muc2 UTSW 7 141701445 missense probably damaging 0.99
R9774:Muc2 UTSW 7 141699242 missense probably benign
R9784:Muc2 UTSW 7 141694542 nonsense probably null
Z1176:Muc2 UTSW 7 141746714 missense
Z1177:Muc2 UTSW 7 141744794 missense
Predicted Primers PCR Primer
(F):5'- ATTCCTGTGGTAAGTGAGGC -3'
(R):5'- TGGCACTTGTTGGAATACACTG -3'

Sequencing Primer
(F):5'- CAGGCTGTGAACAAGGGTCC -3'
(R):5'- CACTTGTTGGAATACACTGGAGATCC -3'
Posted On 2018-05-04