Incidental Mutation 'R6390:Muc2'
ID 515728
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 044539-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R6390 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 141305883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 230 (V230L)
Ref Sequence ENSEMBL: ENSMUSP00000026590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026590]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026590
AA Change: V230L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: V230L

DomainStartEndE-ValueType
C8 1 63 1.65e-11 SMART
VWC 120 188 5.48e-2 SMART
VWC 229 293 2.38e-11 SMART
Blast:VWD 299 363 4e-17 BLAST
CT 380 463 3.6e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187945
AA Change: V669L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,164,625 (GRCm39) P113Q probably damaging Het
Ccdc150 A G 1: 54,407,176 (GRCm39) D1073G probably benign Het
Cd8a A G 6: 71,350,913 (GRCm39) Y126C probably damaging Het
Cdca8 A G 4: 124,830,168 (GRCm39) M68T probably damaging Het
Cyp2d26 G A 15: 82,676,825 (GRCm39) P174S possibly damaging Het
Dnai3 A G 3: 145,801,143 (GRCm39) L105P probably damaging Het
Esco1 T G 18: 10,567,528 (GRCm39) N311H probably damaging Het
Evx1 A G 6: 52,292,842 (GRCm39) M183V probably benign Het
Fam111a T G 19: 12,565,524 (GRCm39) Y424* probably null Het
Fat4 T C 3: 39,034,529 (GRCm39) I2727T probably damaging Het
Ggt6 T A 11: 72,327,437 (GRCm39) Y107N possibly damaging Het
Habp2 G C 19: 56,295,255 (GRCm39) E49Q possibly damaging Het
Hibadh A C 6: 52,533,474 (GRCm39) L214R probably damaging Het
Ift57 T G 16: 49,582,836 (GRCm39) probably null Het
Irak4 T C 15: 94,459,367 (GRCm39) S328P probably damaging Het
Krtap6-2 A T 16: 89,216,834 (GRCm39) Y44* probably null Het
Lrrc46 T C 11: 96,931,757 (GRCm39) T22A probably damaging Het
Ncan T C 8: 70,567,899 (GRCm39) D71G probably benign Het
Nsd2 T C 5: 34,038,525 (GRCm39) S779P probably damaging Het
Rps6ka5 G T 12: 100,537,251 (GRCm39) T493K probably damaging Het
Slc6a21 A T 7: 44,936,426 (GRCm39) M135L probably benign Het
Sprtn A G 8: 125,629,958 (GRCm39) N417S probably benign Het
Trim61 T A 8: 65,466,842 (GRCm39) M140L probably benign Het
Vars1 C A 17: 35,234,615 (GRCm39) A1148E probably benign Het
Vmn2r106 C T 17: 20,488,725 (GRCm39) C558Y probably damaging Het
Vmn2r112 T C 17: 22,824,230 (GRCm39) V495A probably benign Het
Vmn2r117 A T 17: 23,679,088 (GRCm39) V712E possibly damaging Het
Wdfy4 T C 14: 32,826,051 (GRCm39) D1200G probably damaging Het
Zbtb6 A T 2: 37,318,690 (GRCm39) S413T probably benign Het
Zp2 G T 7: 119,740,453 (GRCm39) N170K probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATTCCTGTGGTAAGTGAGGC -3'
(R):5'- TGGCACTTGTTGGAATACACTG -3'

Sequencing Primer
(F):5'- CAGGCTGTGAACAAGGGTCC -3'
(R):5'- CACTTGTTGGAATACACTGGAGATCC -3'
Posted On 2018-05-04