Incidental Mutation 'R6390:Ncan'
ID 515730
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3, Cspg3-rs, neurocan, Tgfbit
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6390 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70093085-70120873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70115249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 71 (D71G)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002412
AA Change: D71G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: D71G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Meta Mutation Damage Score 0.1687 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2320:Ncan UTSW 8 70108218 missense probably benign
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4155:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6223:Ncan UTSW 8 70109954 missense probably benign 0.02
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7293:Ncan UTSW 8 70115211 missense probably damaging 0.98
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
R7779:Ncan UTSW 8 70115011 missense probably damaging 0.99
R7973:Ncan UTSW 8 70097575 missense probably benign 0.00
R8113:Ncan UTSW 8 70108571 missense possibly damaging 0.58
R8269:Ncan UTSW 8 70107680 missense probably benign 0.01
R8947:Ncan UTSW 8 70102521 missense probably damaging 0.98
R9324:Ncan UTSW 8 70107998 missense possibly damaging 0.75
R9717:Ncan UTSW 8 70101978 missense probably damaging 1.00
R9803:Ncan UTSW 8 70108101 missense probably benign 0.06
Z1177:Ncan UTSW 8 70097472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACAGCCCAGAGTCGCTTG -3'
(R):5'- ACTAAAGCAAGAAATGTTAGTGCCC -3'

Sequencing Primer
(F):5'- AGAGTCGCTTGCTCGAAG -3'
(R):5'- GAAATGTTAGTGCCCACCCC -3'
Posted On 2018-05-04