Incidental Mutation 'R6390:Krtap6-2'
ID515739
Institutional Source Beutler Lab
Gene Symbol Krtap6-2
Ensembl Gene ENSMUSG00000062433
Gene Namekeratin associated protein 6-2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6390 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location89419326-89420111 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 89419946 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 44 (Y44*)
Ref Sequence ENSEMBL: ENSMUSP00000139661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082065]
Predicted Effect probably null
Transcript: ENSMUST00000082065
AA Change: Y44*
SMART Domains Protein: ENSMUSP00000139661
Gene: ENSMUSG00000062433
AA Change: Y44*

DomainStartEndE-ValueType
low complexity region 2 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Krtap6-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03375:Krtap6-2 APN 16 89419756 missense unknown
R1566:Krtap6-2 UTSW 16 89419738 missense unknown
R4896:Krtap6-2 UTSW 16 89419918 missense unknown
R5857:Krtap6-2 UTSW 16 89419642 missense unknown
R6958:Krtap6-2 UTSW 16 89419810 missense unknown
R7432:Krtap6-2 UTSW 16 89419873 missense unknown
R7454:Krtap6-2 UTSW 16 89419912 missense unknown
R7780:Krtap6-2 UTSW 16 89419622 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCGTATCCAGAGCCATAG -3'
(R):5'- TCTTTTGCAACCCAAGTGAAC -3'

Sequencing Primer
(F):5'- GTATCCAGAGCCATAGCCAGAG -3'
(R):5'- GTGAACTCTCCTCTATTGACAACATG -3'
Posted On2018-05-04