Incidental Mutation 'R6391:Slx4ip'
ID515752
Institutional Source Beutler Lab
Gene Symbol Slx4ip
Ensembl Gene ENSMUSG00000027281
Gene NameSLX4 interacting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6391 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location136891218-137071950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137046749 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 117 (C117S)
Ref Sequence ENSEMBL: ENSMUSP00000136131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028737] [ENSMUST00000099311] [ENSMUST00000180277]
Predicted Effect probably benign
Transcript: ENSMUST00000028737
SMART Domains Protein: ENSMUSP00000028737
Gene: ENSMUSG00000027281

DomainStartEndE-ValueType
low complexity region 271 292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099311
AA Change: C117S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096914
Gene: ENSMUSG00000027281
AA Change: C117S

DomainStartEndE-ValueType
Pfam:UPF0492 10 365 6.4e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135260
Predicted Effect probably damaging
Transcript: ENSMUST00000180277
AA Change: C117S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136131
Gene: ENSMUSG00000027281
AA Change: C117S

DomainStartEndE-ValueType
low complexity region 341 362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl7b G T 5: 135,180,025 S114I probably damaging Het
Cct8 A T 16: 87,487,678 M207K probably benign Het
Cnga1 A G 5: 72,612,359 probably null Het
Cst13 T C 2: 148,828,191 C94R probably damaging Het
Cyp8b1 G T 9: 121,915,798 S156* probably null Het
Dip2b T C 15: 100,151,276 S184P probably damaging Het
Dmbt1 T C 7: 131,058,254 W516R probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Drosha T A 15: 12,889,717 C890* probably null Het
Eed A G 7: 89,976,941 S75P probably benign Het
Etaa1 A C 11: 17,946,833 I428S probably benign Het
F5 A T 1: 164,193,493 D1179V probably damaging Het
Fat1 T C 8: 44,952,342 V710A possibly damaging Het
Fmo4 G A 1: 162,793,969 Q558* probably null Het
Gm11639 T C 11: 104,994,317 L4134S possibly damaging Het
Gm7361 A G 5: 26,258,962 I72V probably benign Het
Grm4 A G 17: 27,435,320 V552A probably benign Het
Krt13 T A 11: 100,119,376 I260F probably damaging Het
Krtap3-3 T C 11: 99,550,664 D49G probably damaging Het
Lpin1 T C 12: 16,564,553 E409G probably benign Het
Ly9 A G 1: 171,601,008 V238A possibly damaging Het
Map2k6 T C 11: 110,490,877 probably null Het
Mylk2 T C 2: 152,917,395 L362P probably damaging Het
Olfr1225 T A 2: 89,170,598 I205F probably benign Het
Olfr1264 A G 2: 90,021,631 V145A probably benign Het
Olfr575 T A 7: 102,955,415 Y69F possibly damaging Het
Pcdha9 G A 18: 36,997,919 V14M probably benign Het
Pdzrn4 A T 15: 92,680,537 E380D probably damaging Het
Piezo2 A G 18: 63,106,293 Y739H possibly damaging Het
Pigk A G 3: 152,740,849 H195R probably benign Het
Plin2 T C 4: 86,661,999 D175G probably null Het
Plk4 T A 3: 40,808,973 H526Q probably benign Het
Pom121l12 A T 11: 14,599,489 D65V probably damaging Het
Prb1 T C 6: 132,207,176 Y498C unknown Het
Sh3bp2 G A 5: 34,561,603 V495I probably damaging Het
Tmtc2 A T 10: 105,573,690 S20R probably benign Het
Unc79 A G 12: 103,021,010 Y186C probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 T C 6: 124,061,389 L641P probably damaging Het
Wdr17 A T 8: 54,661,460 S674T probably benign Het
Zfp959 T C 17: 55,895,854 F10L probably damaging Het
Other mutations in Slx4ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Slx4ip APN 2 137044055 nonsense probably null
IGL01546:Slx4ip APN 2 137066199 missense probably benign
IGL02114:Slx4ip APN 2 137000200 missense probably damaging 1.00
IGL02142:Slx4ip APN 2 137068022 missense possibly damaging 0.87
IGL02253:Slx4ip APN 2 137000275 critical splice donor site probably null
IGL02826:Slx4ip APN 2 137004973 missense probably damaging 1.00
IGL03035:Slx4ip APN 2 137067703 missense possibly damaging 0.50
IGL03261:Slx4ip APN 2 137046739 missense probably benign 0.01
R0561:Slx4ip UTSW 2 137066170 missense probably null 0.27
R1750:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R1774:Slx4ip UTSW 2 137067723 missense probably damaging 0.99
R1812:Slx4ip UTSW 2 137068195 missense probably benign 0.13
R1894:Slx4ip UTSW 2 137068118 missense probably benign 0.02
R1961:Slx4ip UTSW 2 137067681 missense probably benign 0.02
R2051:Slx4ip UTSW 2 137066205 missense possibly damaging 0.90
R2263:Slx4ip UTSW 2 137044015 missense probably damaging 1.00
R2914:Slx4ip UTSW 2 137067591 critical splice acceptor site probably null
R3798:Slx4ip UTSW 2 137067623 missense probably benign 0.19
R4061:Slx4ip UTSW 2 137005017 missense probably benign 0.08
R4934:Slx4ip UTSW 2 137068347 utr 3 prime probably benign
R4944:Slx4ip UTSW 2 137046767 missense probably benign 0.17
R5061:Slx4ip UTSW 2 137044010 missense probably damaging 1.00
R5465:Slx4ip UTSW 2 137004947 missense probably damaging 1.00
R5609:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R6112:Slx4ip UTSW 2 137046744 missense probably damaging 1.00
R6525:Slx4ip UTSW 2 137000218 missense possibly damaging 0.72
R6868:Slx4ip UTSW 2 137000210 missense probably damaging 1.00
R6944:Slx4ip UTSW 2 137068275 missense probably damaging 1.00
R6966:Slx4ip UTSW 2 137068224 missense probably damaging 0.96
R7214:Slx4ip UTSW 2 137046730 missense probably benign 0.15
R7406:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R7711:Slx4ip UTSW 2 137067994 missense probably damaging 1.00
R8035:Slx4ip UTSW 2 137044025 nonsense probably null
R8181:Slx4ip UTSW 2 137000184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCACTCTGCCCAAGTGG -3'
(R):5'- TGCTGATAATAAAAGACACCCTGG -3'

Sequencing Primer
(F):5'- CAAGTGGTGGAAATCTTGTAGAG -3'
(R):5'- TGATAATAAAAGACACCCTGGAACAC -3'
Posted On2018-05-04