Incidental Mutation 'R6391:Vmn2r26'
ID515762
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Namevomeronasal 2, receptor 26
SynonymsV2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R6391 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124024758-124062035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124061389 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 641 (L641P)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: L641P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: L641P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158682
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl7b G T 5: 135,180,025 S114I probably damaging Het
Cct8 A T 16: 87,487,678 M207K probably benign Het
Cnga1 A G 5: 72,612,359 probably null Het
Cst13 T C 2: 148,828,191 C94R probably damaging Het
Cyp8b1 G T 9: 121,915,798 S156* probably null Het
Dip2b T C 15: 100,151,276 S184P probably damaging Het
Dmbt1 T C 7: 131,058,254 W516R probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Drosha T A 15: 12,889,717 C890* probably null Het
Eed A G 7: 89,976,941 S75P probably benign Het
Etaa1 A C 11: 17,946,833 I428S probably benign Het
F5 A T 1: 164,193,493 D1179V probably damaging Het
Fat1 T C 8: 44,952,342 V710A possibly damaging Het
Fmo4 G A 1: 162,793,969 Q558* probably null Het
Gm11639 T C 11: 104,994,317 L4134S possibly damaging Het
Gm7361 A G 5: 26,258,962 I72V probably benign Het
Grm4 A G 17: 27,435,320 V552A probably benign Het
Krt13 T A 11: 100,119,376 I260F probably damaging Het
Krtap3-3 T C 11: 99,550,664 D49G probably damaging Het
Lpin1 T C 12: 16,564,553 E409G probably benign Het
Ly9 A G 1: 171,601,008 V238A possibly damaging Het
Map2k6 T C 11: 110,490,877 probably null Het
Mylk2 T C 2: 152,917,395 L362P probably damaging Het
Olfr1225 T A 2: 89,170,598 I205F probably benign Het
Olfr1264 A G 2: 90,021,631 V145A probably benign Het
Olfr575 T A 7: 102,955,415 Y69F possibly damaging Het
Pcdha9 G A 18: 36,997,919 V14M probably benign Het
Pdzrn4 A T 15: 92,680,537 E380D probably damaging Het
Piezo2 A G 18: 63,106,293 Y739H possibly damaging Het
Pigk A G 3: 152,740,849 H195R probably benign Het
Plin2 T C 4: 86,661,999 D175G probably null Het
Plk4 T A 3: 40,808,973 H526Q probably benign Het
Pom121l12 A T 11: 14,599,489 D65V probably damaging Het
Prb1 T C 6: 132,207,176 Y498C unknown Het
Sh3bp2 G A 5: 34,561,603 V495I probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Tmtc2 A T 10: 105,573,690 S20R probably benign Het
Unc79 A G 12: 103,021,010 Y186C probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdr17 A T 8: 54,661,460 S674T probably benign Het
Zfp959 T C 17: 55,895,854 F10L probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R7914:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACAGAGGAATCAGTGTCTCC -3'
(R):5'- GCATTTGAGAGTCGGGTCAC -3'

Sequencing Primer
(F):5'- CCCTAAAATTATGGTATTTTTGGCCC -3'
(R):5'- ATTTGAGAGTCGGGTCACCATCC -3'
Posted On2018-05-04