Incidental Mutation 'R6391:Vmn2r26'
ID 515762
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R6391 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124061389 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 641 (L641P)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: L641P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: L641P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158682
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl7b G T 5: 135,180,025 S114I probably damaging Het
Cct8 A T 16: 87,487,678 M207K probably benign Het
Cnga1 A G 5: 72,612,359 probably null Het
Cst13 T C 2: 148,828,191 C94R probably damaging Het
Cyp8b1 G T 9: 121,915,798 S156* probably null Het
Dip2b T C 15: 100,151,276 S184P probably damaging Het
Dmbt1 T C 7: 131,058,254 W516R probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Drosha T A 15: 12,889,717 C890* probably null Het
Eed A G 7: 89,976,941 S75P probably benign Het
Etaa1 A C 11: 17,946,833 I428S probably benign Het
F5 A T 1: 164,193,493 D1179V probably damaging Het
Fat1 T C 8: 44,952,342 V710A possibly damaging Het
Fmo4 G A 1: 162,793,969 Q558* probably null Het
Gm11639 T C 11: 104,994,317 L4134S possibly damaging Het
Gm7361 A G 5: 26,258,962 I72V probably benign Het
Grm4 A G 17: 27,435,320 V552A probably benign Het
Krt13 T A 11: 100,119,376 I260F probably damaging Het
Krtap3-3 T C 11: 99,550,664 D49G probably damaging Het
Lpin1 T C 12: 16,564,553 E409G probably benign Het
Ly9 A G 1: 171,601,008 V238A possibly damaging Het
Map2k6 T C 11: 110,490,877 probably null Het
Mylk2 T C 2: 152,917,395 L362P probably damaging Het
Olfr1225 T A 2: 89,170,598 I205F probably benign Het
Olfr1264 A G 2: 90,021,631 V145A probably benign Het
Olfr575 T A 7: 102,955,415 Y69F possibly damaging Het
Pcdha9 G A 18: 36,997,919 V14M probably benign Het
Pdzrn4 A T 15: 92,680,537 E380D probably damaging Het
Piezo2 A G 18: 63,106,293 Y739H possibly damaging Het
Pigk A G 3: 152,740,849 H195R probably benign Het
Plin2 T C 4: 86,661,999 D175G probably null Het
Plk4 T A 3: 40,808,973 H526Q probably benign Het
Pom121l12 A T 11: 14,599,489 D65V probably damaging Het
Prb1 T C 6: 132,207,176 Y498C unknown Het
Sh3bp2 G A 5: 34,561,603 V495I probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Tmtc2 A T 10: 105,573,690 S20R probably benign Het
Unc79 A G 12: 103,021,010 Y186C probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdr17 A T 8: 54,661,460 S674T probably benign Het
Zfp959 T C 17: 55,895,854 F10L probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACAGAGGAATCAGTGTCTCC -3'
(R):5'- GCATTTGAGAGTCGGGTCAC -3'

Sequencing Primer
(F):5'- CCCTAAAATTATGGTATTTTTGGCCC -3'
(R):5'- ATTTGAGAGTCGGGTCACCATCC -3'
Posted On 2018-05-04