Incidental Mutation 'R6391:Wdr17'
ID515768
Institutional Source Beutler Lab
Gene Symbol Wdr17
Ensembl Gene ENSMUSG00000039375
Gene NameWD repeat domain 17
SynonymsB230207L18Rik, 3010002I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6391 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location54629055-54887184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54661460 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 674 (S674T)
Ref Sequence ENSEMBL: ENSMUSP00000122326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127511] [ENSMUST00000144482] [ENSMUST00000144711] [ENSMUST00000150488] [ENSMUST00000175915]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126316
Predicted Effect probably benign
Transcript: ENSMUST00000127511
AA Change: S698T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115550
Gene: ENSMUSG00000039375
AA Change: S698T

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 162 202 1.58e2 SMART
WD40 205 252 4.26e1 SMART
WD40 255 298 1.15e0 SMART
WD40 383 422 1.59e-7 SMART
WD40 425 465 2.39e0 SMART
WD40 468 509 5.52e-2 SMART
WD40 511 550 4.14e-6 SMART
WD40 555 595 5.14e-11 SMART
WD40 598 638 6.58e-9 SMART
WD40 641 681 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144482
SMART Domains Protein: ENSMUSP00000134950
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
Blast:WD40 16 65 2e-24 BLAST
WD40 70 109 1.59e-7 SMART
WD40 112 152 2.39e0 SMART
WD40 155 196 5.52e-2 SMART
WD40 198 237 4.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144711
AA Change: S681T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117710
Gene: ENSMUSG00000039375
AA Change: S681T

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 194 235 7.64e1 SMART
WD40 238 281 1.15e0 SMART
WD40 366 405 1.59e-7 SMART
WD40 408 448 2.39e0 SMART
WD40 451 492 5.52e-2 SMART
WD40 494 533 4.14e-6 SMART
WD40 538 578 5.14e-11 SMART
WD40 581 621 6.58e-9 SMART
WD40 624 664 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150488
AA Change: S674T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122326
Gene: ENSMUSG00000039375
AA Change: S674T

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175915
AA Change: S674T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135805
Gene: ENSMUSG00000039375
AA Change: S674T

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein. It is abundantly expressed in retina and testis, and is thought to be a candidate gene for retinal disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl7b G T 5: 135,180,025 S114I probably damaging Het
Cct8 A T 16: 87,487,678 M207K probably benign Het
Cnga1 A G 5: 72,612,359 probably null Het
Cst13 T C 2: 148,828,191 C94R probably damaging Het
Cyp8b1 G T 9: 121,915,798 S156* probably null Het
Dip2b T C 15: 100,151,276 S184P probably damaging Het
Dmbt1 T C 7: 131,058,254 W516R probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Drosha T A 15: 12,889,717 C890* probably null Het
Eed A G 7: 89,976,941 S75P probably benign Het
Etaa1 A C 11: 17,946,833 I428S probably benign Het
F5 A T 1: 164,193,493 D1179V probably damaging Het
Fat1 T C 8: 44,952,342 V710A possibly damaging Het
Fmo4 G A 1: 162,793,969 Q558* probably null Het
Gm11639 T C 11: 104,994,317 L4134S possibly damaging Het
Gm7361 A G 5: 26,258,962 I72V probably benign Het
Grm4 A G 17: 27,435,320 V552A probably benign Het
Krt13 T A 11: 100,119,376 I260F probably damaging Het
Krtap3-3 T C 11: 99,550,664 D49G probably damaging Het
Lpin1 T C 12: 16,564,553 E409G probably benign Het
Ly9 A G 1: 171,601,008 V238A possibly damaging Het
Map2k6 T C 11: 110,490,877 probably null Het
Mylk2 T C 2: 152,917,395 L362P probably damaging Het
Olfr1225 T A 2: 89,170,598 I205F probably benign Het
Olfr1264 A G 2: 90,021,631 V145A probably benign Het
Olfr575 T A 7: 102,955,415 Y69F possibly damaging Het
Pcdha9 G A 18: 36,997,919 V14M probably benign Het
Pdzrn4 A T 15: 92,680,537 E380D probably damaging Het
Piezo2 A G 18: 63,106,293 Y739H possibly damaging Het
Pigk A G 3: 152,740,849 H195R probably benign Het
Plin2 T C 4: 86,661,999 D175G probably null Het
Plk4 T A 3: 40,808,973 H526Q probably benign Het
Pom121l12 A T 11: 14,599,489 D65V probably damaging Het
Prb1 T C 6: 132,207,176 Y498C unknown Het
Sh3bp2 G A 5: 34,561,603 V495I probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Tmtc2 A T 10: 105,573,690 S20R probably benign Het
Unc79 A G 12: 103,021,010 Y186C probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 T C 6: 124,061,389 L641P probably damaging Het
Zfp959 T C 17: 55,895,854 F10L probably damaging Het
Other mutations in Wdr17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Wdr17 APN 8 54687711 missense probably damaging 1.00
IGL00496:Wdr17 APN 8 54659579 splice site probably benign
IGL01318:Wdr17 APN 8 54672550 missense probably damaging 1.00
IGL01347:Wdr17 APN 8 54651345 missense probably benign
IGL01654:Wdr17 APN 8 54662879 missense probably damaging 1.00
IGL02010:Wdr17 APN 8 54659703 missense probably damaging 0.97
IGL02085:Wdr17 APN 8 54687736 nonsense probably null
IGL02205:Wdr17 APN 8 54696300 missense probably damaging 1.00
IGL02375:Wdr17 APN 8 54696388 missense possibly damaging 0.94
IGL02705:Wdr17 APN 8 54648215 splice site probably null
IGL02719:Wdr17 APN 8 54693054 splice site probably null
IGL03051:Wdr17 APN 8 54651314 missense probably damaging 0.99
IGL03131:Wdr17 APN 8 54696267 critical splice donor site probably null
IGL03172:Wdr17 APN 8 54661480 missense probably damaging 0.96
enthralled UTSW 8 54659681 missense possibly damaging 0.85
riveted UTSW 8 54632487 missense probably benign 0.00
thrilled UTSW 8 54696268 critical splice donor site probably null
IGL03138:Wdr17 UTSW 8 54649143 missense probably damaging 1.00
PIT4458001:Wdr17 UTSW 8 54673579 nonsense probably null
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0124:Wdr17 UTSW 8 54635491 missense probably damaging 1.00
R0226:Wdr17 UTSW 8 54663008 missense probably benign 0.08
R0270:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0271:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0288:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0321:Wdr17 UTSW 8 54696268 critical splice donor site probably null
R0464:Wdr17 UTSW 8 54670392 splice site probably benign
R0479:Wdr17 UTSW 8 54651421 splice site probably null
R0488:Wdr17 UTSW 8 54693052 unclassified probably benign
R0552:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0553:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0600:Wdr17 UTSW 8 54661495 missense probably damaging 1.00
R0621:Wdr17 UTSW 8 54643191 missense probably benign 0.18
R0655:Wdr17 UTSW 8 54649198 missense probably damaging 1.00
R0730:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0789:Wdr17 UTSW 8 54659572 splice site probably benign
R0854:Wdr17 UTSW 8 54703881 missense probably benign
R0879:Wdr17 UTSW 8 54661481 missense probably benign 0.08
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1497:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R1589:Wdr17 UTSW 8 54703907 intron probably benign
R1618:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R1768:Wdr17 UTSW 8 54673654 missense possibly damaging 0.84
R1778:Wdr17 UTSW 8 54690214 missense probably damaging 1.00
R1819:Wdr17 UTSW 8 54690124 missense probably benign 0.18
R1913:Wdr17 UTSW 8 54687726 missense probably damaging 1.00
R2129:Wdr17 UTSW 8 54632381 missense probably damaging 1.00
R2132:Wdr17 UTSW 8 54672506 missense probably damaging 1.00
R2309:Wdr17 UTSW 8 54643248 missense probably benign
R3882:Wdr17 UTSW 8 54639501 missense possibly damaging 0.53
R4097:Wdr17 UTSW 8 54635469 missense probably damaging 1.00
R4372:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R4380:Wdr17 UTSW 8 54648407 intron probably benign
R4480:Wdr17 UTSW 8 54664964 critical splice donor site probably null
R4654:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4656:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4669:Wdr17 UTSW 8 54690048 missense possibly damaging 0.72
R4719:Wdr17 UTSW 8 54639876 missense probably benign 0.33
R4912:Wdr17 UTSW 8 54629861 missense probably damaging 1.00
R5000:Wdr17 UTSW 8 54665126 missense possibly damaging 0.82
R5073:Wdr17 UTSW 8 54690236 critical splice acceptor site probably null
R5176:Wdr17 UTSW 8 54653878 critical splice donor site probably null
R5194:Wdr17 UTSW 8 54687604 missense probably damaging 1.00
R5270:Wdr17 UTSW 8 54643186 missense probably benign 0.20
R5300:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5325:Wdr17 UTSW 8 54659681 missense possibly damaging 0.85
R5336:Wdr17 UTSW 8 54632318 missense probably damaging 1.00
R5394:Wdr17 UTSW 8 54639489 missense possibly damaging 0.73
R5424:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5425:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5426:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5548:Wdr17 UTSW 8 54703851 missense probably damaging 0.97
R5681:Wdr17 UTSW 8 54662869 missense probably damaging 1.00
R5722:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R5894:Wdr17 UTSW 8 54696300 missense probably damaging 1.00
R5906:Wdr17 UTSW 8 54639468 missense probably benign 0.33
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6605:Wdr17 UTSW 8 54681524 missense probably benign 0.16
R6892:Wdr17 UTSW 8 54673596 missense probably damaging 1.00
R7019:Wdr17 UTSW 8 54681453 missense probably damaging 1.00
R7257:Wdr17 UTSW 8 54632487 missense probably benign 0.00
R7481:Wdr17 UTSW 8 54661336 missense probably benign
R7868:Wdr17 UTSW 8 54696267 critical splice donor site probably null
R7939:Wdr17 UTSW 8 54687642 missense probably damaging 0.98
R7962:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R8017:Wdr17 UTSW 8 54638368 missense possibly damaging 0.73
R8122:Wdr17 UTSW 8 54664976 missense probably damaging 1.00
R8226:Wdr17 UTSW 8 54693120 missense possibly damaging 0.52
R8251:Wdr17 UTSW 8 54657232 missense probably damaging 1.00
R8413:Wdr17 UTSW 8 54662918 missense probably benign 0.08
R8534:Wdr17 UTSW 8 54648230 missense probably benign 0.08
V5088:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
X0022:Wdr17 UTSW 8 54639494 missense probably benign 0.04
X0066:Wdr17 UTSW 8 54673560 missense probably damaging 1.00
Z1177:Wdr17 UTSW 8 54643185 missense probably benign 0.03
Z1177:Wdr17 UTSW 8 54670379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGACACTTTGCCGCAG -3'
(R):5'- AGCCTCTGAGTTACTCACATTC -3'

Sequencing Primer
(F):5'- TGACACTTTGCCGCAGAGGAG -3'
(R):5'- CTGAGTTACTCACATTCCTTCATAAC -3'
Posted On2018-05-04