Incidental Mutation 'R6391:Etaa1'
ID515772
Institutional Source Beutler Lab
Gene Symbol Etaa1
Ensembl Gene ENSMUSG00000016984
Gene NameEwing tumor-associated antigen 1
Synonyms5730466H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6391 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location17938756-17953875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 17946833 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 428 (I428S)
Ref Sequence ENSEMBL: ENSMUSP00000075957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076661]
Predicted Effect probably benign
Transcript: ENSMUST00000076661
AA Change: I428S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075957
Gene: ENSMUSG00000016984
AA Change: I428S

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ETAA1 79 865 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl7b G T 5: 135,180,025 S114I probably damaging Het
Cct8 A T 16: 87,487,678 M207K probably benign Het
Cnga1 A G 5: 72,612,359 probably null Het
Cst13 T C 2: 148,828,191 C94R probably damaging Het
Cyp8b1 G T 9: 121,915,798 S156* probably null Het
Dip2b T C 15: 100,151,276 S184P probably damaging Het
Dmbt1 T C 7: 131,058,254 W516R probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Drosha T A 15: 12,889,717 C890* probably null Het
Eed A G 7: 89,976,941 S75P probably benign Het
F5 A T 1: 164,193,493 D1179V probably damaging Het
Fat1 T C 8: 44,952,342 V710A possibly damaging Het
Fmo4 G A 1: 162,793,969 Q558* probably null Het
Gm11639 T C 11: 104,994,317 L4134S possibly damaging Het
Gm7361 A G 5: 26,258,962 I72V probably benign Het
Grm4 A G 17: 27,435,320 V552A probably benign Het
Krt13 T A 11: 100,119,376 I260F probably damaging Het
Krtap3-3 T C 11: 99,550,664 D49G probably damaging Het
Lpin1 T C 12: 16,564,553 E409G probably benign Het
Ly9 A G 1: 171,601,008 V238A possibly damaging Het
Map2k6 T C 11: 110,490,877 probably null Het
Mylk2 T C 2: 152,917,395 L362P probably damaging Het
Olfr1225 T A 2: 89,170,598 I205F probably benign Het
Olfr1264 A G 2: 90,021,631 V145A probably benign Het
Olfr575 T A 7: 102,955,415 Y69F possibly damaging Het
Pcdha9 G A 18: 36,997,919 V14M probably benign Het
Pdzrn4 A T 15: 92,680,537 E380D probably damaging Het
Piezo2 A G 18: 63,106,293 Y739H possibly damaging Het
Pigk A G 3: 152,740,849 H195R probably benign Het
Plin2 T C 4: 86,661,999 D175G probably null Het
Plk4 T A 3: 40,808,973 H526Q probably benign Het
Pom121l12 A T 11: 14,599,489 D65V probably damaging Het
Prb1 T C 6: 132,207,176 Y498C unknown Het
Sh3bp2 G A 5: 34,561,603 V495I probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Tmtc2 A T 10: 105,573,690 S20R probably benign Het
Unc79 A G 12: 103,021,010 Y186C probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 T C 6: 124,061,389 L641P probably damaging Het
Wdr17 A T 8: 54,661,460 S674T probably benign Het
Zfp959 T C 17: 55,895,854 F10L probably damaging Het
Other mutations in Etaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Etaa1 APN 11 17947825 nonsense probably null
IGL00555:Etaa1 APN 11 17947535 missense probably damaging 1.00
IGL01098:Etaa1 APN 11 17946059 missense probably damaging 0.99
IGL01100:Etaa1 APN 11 17952576 critical splice donor site probably null
IGL01312:Etaa1 APN 11 17945909 missense probably damaging 1.00
IGL01391:Etaa1 APN 11 17946005 missense probably damaging 1.00
IGL01607:Etaa1 APN 11 17953637 missense probably benign 0.00
IGL02066:Etaa1 APN 11 17946687 missense probably benign
R0401:Etaa1 UTSW 11 17947514 missense probably damaging 1.00
R0413:Etaa1 UTSW 11 17946350 nonsense probably null
R0790:Etaa1 UTSW 11 17946051 missense probably benign 0.00
R1442:Etaa1 UTSW 11 17947201 missense probably benign 0.19
R1447:Etaa1 UTSW 11 17946625 missense possibly damaging 0.92
R1647:Etaa1 UTSW 11 17946492 missense probably damaging 0.99
R1945:Etaa1 UTSW 11 17947233 missense probably damaging 0.96
R1996:Etaa1 UTSW 11 17952671 missense probably damaging 1.00
R2211:Etaa1 UTSW 11 17952686 nonsense probably null
R2338:Etaa1 UTSW 11 17945605 critical splice donor site probably null
R3027:Etaa1 UTSW 11 17947886 missense probably damaging 1.00
R3546:Etaa1 UTSW 11 17953823 start gained probably benign
R4118:Etaa1 UTSW 11 17946180 missense probably benign 0.18
R4156:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
R4657:Etaa1 UTSW 11 17946964 missense possibly damaging 0.81
R4882:Etaa1 UTSW 11 17946174 missense probably benign 0.10
R4914:Etaa1 UTSW 11 17946532 missense probably benign 0.05
R4978:Etaa1 UTSW 11 17946581 missense probably damaging 0.99
R5202:Etaa1 UTSW 11 17947853 missense probably damaging 1.00
R5384:Etaa1 UTSW 11 17947539 missense probably damaging 1.00
R5584:Etaa1 UTSW 11 17947406 missense possibly damaging 0.72
R6303:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6304:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6351:Etaa1 UTSW 11 17947188 missense possibly damaging 0.95
R6685:Etaa1 UTSW 11 17953582 missense probably benign 0.40
R6705:Etaa1 UTSW 11 17945639 missense probably benign 0.02
R6807:Etaa1 UTSW 11 17952680 missense probably benign
R6863:Etaa1 UTSW 11 17953794 start codon destroyed probably benign 0.01
R6985:Etaa1 UTSW 11 17946108 missense probably damaging 0.99
R7129:Etaa1 UTSW 11 17940339 missense possibly damaging 0.92
R7429:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
Z1088:Etaa1 UTSW 11 17946465 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GCTAGTGACAGATTTCTCAAAACTC -3'
(R):5'- TGTGACTCCCTGTCCTAAGAC -3'

Sequencing Primer
(F):5'- ACTCACTTTATTTCCTGTGAATGG -3'
(R):5'- GCACCTGATACACAGCTTGATGAG -3'
Posted On2018-05-04