Mutagenetix > Incidental Mutation

Incidental Mutation 'R6391:Pdzrn4'

515780

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

044540-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R6391 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92680537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 380 (E380D)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035399
AA Change: E141D

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: E141D

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169942
AA Change: E380D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: E380D

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229173

Meta Mutation Damage Score

0.1153

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl7b	G	T	5: 135,180,025	S114I	probably damaging	Het
Cct8	A	T	16: 87,487,678	M207K	probably benign	Het
Cnga1	A	G	5: 72,612,359		probably null	Het
Cst13	T	C	2: 148,828,191	C94R	probably damaging	Het
Cyp8b1	G	T	9: 121,915,798	S156*	probably null	Het
Dip2b	T	C	15: 100,151,276	S184P	probably damaging	Het
Dmbt1	T	C	7: 131,058,254	W516R	probably damaging	Het
Dock8	A	T	19: 25,095,550	Y398F	possibly damaging	Het
Drosha	T	A	15: 12,889,717	C890*	probably null	Het
Eed	A	G	7: 89,976,941	S75P	probably benign	Het
Etaa1	A	C	11: 17,946,833	I428S	probably benign	Het
F5	A	T	1: 164,193,493	D1179V	probably damaging	Het
Fat1	T	C	8: 44,952,342	V710A	possibly damaging	Het
Fmo4	G	A	1: 162,793,969	Q558*	probably null	Het
Gm11639	T	C	11: 104,994,317	L4134S	possibly damaging	Het
Gm7361	A	G	5: 26,258,962	I72V	probably benign	Het
Grm4	A	G	17: 27,435,320	V552A	probably benign	Het
Krt13	T	A	11: 100,119,376	I260F	probably damaging	Het
Krtap3-3	T	C	11: 99,550,664	D49G	probably damaging	Het
Lpin1	T	C	12: 16,564,553	E409G	probably benign	Het
Ly9	A	G	1: 171,601,008	V238A	possibly damaging	Het
Map2k6	T	C	11: 110,490,877		probably null	Het
Mylk2	T	C	2: 152,917,395	L362P	probably damaging	Het
Olfr1225	T	A	2: 89,170,598	I205F	probably benign	Het
Olfr1264	A	G	2: 90,021,631	V145A	probably benign	Het
Olfr575	T	A	7: 102,955,415	Y69F	possibly damaging	Het
Pcdha9	G	A	18: 36,997,919	V14M	probably benign	Het
Piezo2	A	G	18: 63,106,293	Y739H	possibly damaging	Het
Pigk	A	G	3: 152,740,849	H195R	probably benign	Het
Plin2	T	C	4: 86,661,999	D175G	probably null	Het
Plk4	T	A	3: 40,808,973	H526Q	probably benign	Het
Pom121l12	A	T	11: 14,599,489	D65V	probably damaging	Het
Prb1	T	C	6: 132,207,176	Y498C	unknown	Het
Sh3bp2	G	A	5: 34,561,603	V495I	probably damaging	Het
Slx4ip	T	A	2: 137,046,749	C117S	probably damaging	Het
Tmtc2	A	T	10: 105,573,690	S20R	probably benign	Het
Unc79	A	G	12: 103,021,010	Y186C	probably damaging	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Vmn2r26	T	C	6: 124,061,389	L641P	probably damaging	Het
Wdr17	A	T	8: 54,661,460	S674T	probably benign	Het
Zfp959	T	C	17: 55,895,854	F10L	probably damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGCTAGCAAACTTACTCCAAAGTAG -3'
(R):5'- TGATGGTGCACACATATTTTGC -3'

Sequencing Primer
(F):5'- GGCGCGAGATGAAATTCTAAACTCC -3'
(R):5'- GGTGCACACATATTTTGCAAATCTC -3'

Posted On

2018-05-04