Incidental Mutation 'R6391:Pdzrn4'
ID 515780
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, SAMCAP3L, LNX4
MMRRC Submission 044540-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R6391 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 92294762-92669700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92578418 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 380 (E380D)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000035399
AA Change: E141D

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: E141D

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169942
AA Change: E380D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: E380D

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229173
Meta Mutation Damage Score 0.1153 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl7b G T 5: 135,208,879 (GRCm39) S114I probably damaging Het
Cct8 A T 16: 87,284,566 (GRCm39) M207K probably benign Het
Cnga1 A G 5: 72,769,702 (GRCm39) probably null Het
Cst13 T C 2: 148,670,111 (GRCm39) C94R probably damaging Het
Cyp8b1 G T 9: 121,744,864 (GRCm39) S156* probably null Het
Dip2b T C 15: 100,049,157 (GRCm39) S184P probably damaging Het
Dmbt1 T C 7: 130,659,984 (GRCm39) W516R probably damaging Het
Dock8 A T 19: 25,072,914 (GRCm39) Y398F possibly damaging Het
Drosha T A 15: 12,889,803 (GRCm39) C890* probably null Het
Eed A G 7: 89,626,149 (GRCm39) S75P probably benign Het
Efcab3 T C 11: 104,885,143 (GRCm39) L4134S possibly damaging Het
Etaa1 A C 11: 17,896,833 (GRCm39) I428S probably benign Het
F5 A T 1: 164,021,062 (GRCm39) D1179V probably damaging Het
Fat1 T C 8: 45,405,379 (GRCm39) V710A possibly damaging Het
Fmo4 G A 1: 162,621,538 (GRCm39) Q558* probably null Het
Gm7361 A G 5: 26,463,960 (GRCm39) I72V probably benign Het
Grm4 A G 17: 27,654,294 (GRCm39) V552A probably benign Het
Krt13 T A 11: 100,010,202 (GRCm39) I260F probably damaging Het
Krtap3-3 T C 11: 99,441,490 (GRCm39) D49G probably damaging Het
Lpin1 T C 12: 16,614,554 (GRCm39) E409G probably benign Het
Ly9 A G 1: 171,428,576 (GRCm39) V238A possibly damaging Het
Map2k6 T C 11: 110,381,703 (GRCm39) probably null Het
Mylk2 T C 2: 152,759,315 (GRCm39) L362P probably damaging Het
Or4c120 T A 2: 89,000,942 (GRCm39) I205F probably benign Het
Or4c3 A G 2: 89,851,975 (GRCm39) V145A probably benign Het
Or51a6 T A 7: 102,604,622 (GRCm39) Y69F possibly damaging Het
Pcdha9 G A 18: 37,130,972 (GRCm39) V14M probably benign Het
Piezo2 A G 18: 63,239,364 (GRCm39) Y739H possibly damaging Het
Pigk A G 3: 152,446,486 (GRCm39) H195R probably benign Het
Plin2 T C 4: 86,580,236 (GRCm39) D175G probably null Het
Plk4 T A 3: 40,763,408 (GRCm39) H526Q probably benign Het
Pom121l12 A T 11: 14,549,489 (GRCm39) D65V probably damaging Het
Prb1a T C 6: 132,184,139 (GRCm39) Y498C unknown Het
Sh3bp2 G A 5: 34,718,947 (GRCm39) V495I probably damaging Het
Slx4ip T A 2: 136,888,669 (GRCm39) C117S probably damaging Het
Tmtc2 A T 10: 105,409,551 (GRCm39) S20R probably benign Het
Unc79 A G 12: 102,987,269 (GRCm39) Y186C probably damaging Het
Vmn2r106 C T 17: 20,488,725 (GRCm39) C558Y probably damaging Het
Vmn2r26 T C 6: 124,038,348 (GRCm39) L641P probably damaging Het
Wdr17 A T 8: 55,114,495 (GRCm39) S674T probably benign Het
Zfp959 T C 17: 56,202,854 (GRCm39) F10L probably damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92,644,159 (GRCm39) missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92,299,807 (GRCm39) splice site probably null
IGL02103:Pdzrn4 APN 15 92,667,768 (GRCm39) missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92,668,577 (GRCm39) missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92,667,731 (GRCm39) missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92,668,272 (GRCm39) missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92,667,762 (GRCm39) missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92,668,200 (GRCm39) missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92,655,538 (GRCm39) missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92,655,592 (GRCm39) missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92,668,152 (GRCm39) missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92,668,894 (GRCm39) makesense probably null
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92,575,593 (GRCm39) missense probably benign
R1503:Pdzrn4 UTSW 15 92,297,685 (GRCm39) missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92,575,518 (GRCm39) missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92,299,855 (GRCm39) missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92,644,190 (GRCm39) splice site probably null
R2061:Pdzrn4 UTSW 15 92,668,041 (GRCm39) missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92,667,692 (GRCm39) missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92,297,630 (GRCm39) missense probably benign
R4032:Pdzrn4 UTSW 15 92,667,414 (GRCm39) missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92,668,745 (GRCm39) missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92,299,898 (GRCm39) missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92,668,470 (GRCm39) missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92,667,723 (GRCm39) missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92,668,133 (GRCm39) nonsense probably null
R4900:Pdzrn4 UTSW 15 92,668,638 (GRCm39) missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92,575,502 (GRCm39) missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92,668,806 (GRCm39) missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92,295,255 (GRCm39) missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6613:Pdzrn4 UTSW 15 92,575,455 (GRCm39) missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92,668,303 (GRCm39) nonsense probably null
R7096:Pdzrn4 UTSW 15 92,295,384 (GRCm39) missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92,667,948 (GRCm39) missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92,575,605 (GRCm39) missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92,641,476 (GRCm39) missense probably damaging 1.00
R8324:Pdzrn4 UTSW 15 92,668,818 (GRCm39) missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92,295,216 (GRCm39) missense probably benign
R9555:Pdzrn4 UTSW 15 92,297,703 (GRCm39) missense probably damaging 1.00
R9558:Pdzrn4 UTSW 15 92,299,877 (GRCm39) missense possibly damaging 0.46
R9622:Pdzrn4 UTSW 15 92,294,949 (GRCm39) missense probably benign
R9763:Pdzrn4 UTSW 15 92,668,376 (GRCm39) missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92,578,353 (GRCm39) missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92,575,590 (GRCm39) missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92,578,393 (GRCm39) missense possibly damaging 0.92
X0027:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0065:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92,294,838 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTAGCAAACTTACTCCAAAGTAG -3'
(R):5'- TGATGGTGCACACATATTTTGC -3'

Sequencing Primer
(F):5'- GGCGCGAGATGAAATTCTAAACTCC -3'
(R):5'- GGTGCACACATATTTTGCAAATCTC -3'
Posted On 2018-05-04