Incidental Mutation 'R6392:Disp2'
ID 515794
Institutional Source Beutler Lab
Gene Symbol Disp2
Ensembl Gene ENSMUSG00000040035
Gene Name dispatched RND transporter family member 2
Synonyms B230210L08Rik, DispB
MMRRC Submission 044541-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.896) question?
Stock # R6392 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 118610183-118625656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118621230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 654 (V654A)
Ref Sequence ENSEMBL: ENSMUSP00000037136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]
AlphaFold Q8CIP5
Predicted Effect probably damaging
Transcript: ENSMUST00000037547
AA Change: V654A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: V654A

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Pfam:MMPL 435 635 9.7e-8 PFAM
Pfam:Sterol-sensing 458 611 9.1e-9 PFAM
transmembrane domain 657 679 N/A INTRINSIC
low complexity region 682 695 N/A INTRINSIC
low complexity region 748 761 N/A INTRINSIC
transmembrane domain 914 936 N/A INTRINSIC
transmembrane domain 943 965 N/A INTRINSIC
transmembrane domain 975 997 N/A INTRINSIC
transmembrane domain 1018 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063975
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110843
SMART Domains Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110846
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142072
Meta Mutation Damage Score 0.4287 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,825,526 (GRCm39) I330F probably damaging Het
Abcc9 A G 6: 142,627,825 (GRCm39) S402P probably damaging Het
Ada A G 2: 163,570,137 (GRCm39) L292P probably damaging Het
Adam34l A T 8: 44,079,038 (GRCm39) N395K probably benign Het
Adra1d T C 2: 131,403,529 (GRCm39) D187G probably damaging Het
AI467606 C A 7: 126,691,717 (GRCm39) Y97* probably null Het
Arid2 A G 15: 96,259,483 (GRCm39) E245G probably damaging Het
Ccdc78 C G 17: 26,007,148 (GRCm39) Q213E probably damaging Het
Cntnap1 G T 11: 101,077,472 (GRCm39) D1045Y probably damaging Het
Ctcf T C 8: 106,390,765 (GRCm39) V124A probably damaging Het
Cutc T C 19: 43,748,489 (GRCm39) S129P possibly damaging Het
Dhx36 T C 3: 62,401,790 (GRCm39) I308V probably benign Het
Esm1 G A 13: 113,346,283 (GRCm39) probably benign Het
Extl1 C T 4: 134,091,945 (GRCm39) V303I probably benign Het
Ezh1 G T 11: 101,094,630 (GRCm39) D387E probably damaging Het
Fbf1 T A 11: 116,043,775 (GRCm39) probably null Het
Fbxl12 T C 9: 20,550,472 (GRCm39) H84R probably damaging Het
Fbxo6 C T 4: 148,230,462 (GRCm39) V267I probably benign Het
Helz G T 11: 107,493,167 (GRCm39) A197S possibly damaging Het
Ikbke T C 1: 131,202,883 (GRCm39) probably null Het
Kbtbd13 A G 9: 65,297,619 (GRCm39) F439S possibly damaging Het
Kif7 G A 7: 79,351,934 (GRCm39) R943W probably damaging Het
Lrp12 C T 15: 39,735,415 (GRCm39) C839Y probably damaging Het
Matr3 A G 18: 35,717,894 (GRCm39) D364G probably benign Het
Ncam1 T C 9: 49,434,875 (GRCm39) K624E probably damaging Het
Nup205 T C 6: 35,166,820 (GRCm39) S280P possibly damaging Het
Or4a66 A T 2: 88,531,011 (GRCm39) Y221N probably damaging Het
Or52a33 A C 7: 103,288,889 (GRCm39) C153G probably benign Het
Pira2 A T 7: 3,846,901 (GRCm39) S214T possibly damaging Het
Prss3b T C 6: 41,009,306 (GRCm39) Y176C probably damaging Het
Ptpn4 T A 1: 119,700,853 (GRCm39) I30F probably benign Het
Rnf144a T C 12: 26,360,779 (GRCm39) I253V possibly damaging Het
Sh3pxd2b T A 11: 32,373,302 (GRCm39) L823Q possibly damaging Het
Sh3rf3 A T 10: 58,842,898 (GRCm39) D288V probably damaging Het
Shprh T A 10: 11,054,485 (GRCm39) Y1031* probably null Het
Sidt1 T C 16: 44,111,657 (GRCm39) T173A possibly damaging Het
Smc1b C T 15: 84,976,232 (GRCm39) R825Q probably benign Het
Ssh3 C T 19: 4,315,399 (GRCm39) R309H probably benign Het
Tagap G T 17: 8,152,893 (GRCm39) G693W probably damaging Het
Tango2 T A 16: 18,119,403 (GRCm39) I143F probably damaging Het
Thsd7a T C 6: 12,468,928 (GRCm39) H550R probably damaging Het
Tmem131 T A 1: 36,920,423 (GRCm39) Q92H probably benign Het
Tnfrsf21 T C 17: 43,327,979 (GRCm39) L31P probably benign Het
Ttn A T 2: 76,730,487 (GRCm39) probably benign Het
Ubash3b T C 9: 40,926,268 (GRCm39) D493G probably damaging Het
Unc13a C T 8: 72,090,453 (GRCm39) G1411D possibly damaging Het
Vmn2r106 C T 17: 20,488,725 (GRCm39) C558Y probably damaging Het
Zfc3h1 A T 10: 115,237,653 (GRCm39) R477S probably damaging Het
Zfp87 C T 13: 67,664,986 (GRCm39) R492K probably benign Het
Other mutations in Disp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Disp2 APN 2 118,616,759 (GRCm39) missense probably damaging 1.00
IGL00970:Disp2 APN 2 118,622,274 (GRCm39) missense probably damaging 1.00
IGL01790:Disp2 APN 2 118,621,361 (GRCm39) missense probably damaging 1.00
IGL01809:Disp2 APN 2 118,617,745 (GRCm39) splice site probably benign
IGL02069:Disp2 APN 2 118,621,161 (GRCm39) missense possibly damaging 0.93
IGL02140:Disp2 APN 2 118,621,350 (GRCm39) missense probably benign
IGL02143:Disp2 APN 2 118,620,450 (GRCm39) missense probably damaging 1.00
IGL02155:Disp2 APN 2 118,622,285 (GRCm39) missense probably damaging 1.00
IGL02884:Disp2 APN 2 118,618,032 (GRCm39) splice site probably benign
IGL03113:Disp2 APN 2 118,621,259 (GRCm39) splice site probably null
IGL03194:Disp2 APN 2 118,618,110 (GRCm39) missense probably damaging 1.00
PIT4453001:Disp2 UTSW 2 118,618,125 (GRCm39) missense probably benign 0.01
R0109:Disp2 UTSW 2 118,622,297 (GRCm39) missense probably damaging 1.00
R0126:Disp2 UTSW 2 118,620,819 (GRCm39) missense probably damaging 1.00
R0603:Disp2 UTSW 2 118,622,487 (GRCm39) missense probably damaging 1.00
R0610:Disp2 UTSW 2 118,622,717 (GRCm39) missense probably benign 0.02
R0639:Disp2 UTSW 2 118,621,325 (GRCm39) missense possibly damaging 0.74
R0673:Disp2 UTSW 2 118,621,325 (GRCm39) missense possibly damaging 0.74
R0755:Disp2 UTSW 2 118,620,243 (GRCm39) missense probably benign 0.00
R0781:Disp2 UTSW 2 118,620,920 (GRCm39) missense probably damaging 1.00
R1110:Disp2 UTSW 2 118,620,920 (GRCm39) missense probably damaging 1.00
R1148:Disp2 UTSW 2 118,636,899 (GRCm39) critical splice donor site probably null
R1148:Disp2 UTSW 2 118,636,899 (GRCm39) critical splice donor site probably null
R1243:Disp2 UTSW 2 118,622,303 (GRCm39) missense probably damaging 1.00
R1587:Disp2 UTSW 2 118,622,064 (GRCm39) missense probably damaging 1.00
R1739:Disp2 UTSW 2 118,622,031 (GRCm39) missense probably damaging 1.00
R1771:Disp2 UTSW 2 118,621,778 (GRCm39) nonsense probably null
R1781:Disp2 UTSW 2 118,623,042 (GRCm39) missense probably damaging 0.96
R1918:Disp2 UTSW 2 118,622,408 (GRCm39) missense probably benign
R1956:Disp2 UTSW 2 118,622,704 (GRCm39) missense probably benign 0.02
R2167:Disp2 UTSW 2 118,622,166 (GRCm39) missense probably damaging 1.00
R2206:Disp2 UTSW 2 118,622,725 (GRCm39) missense probably benign 0.02
R4031:Disp2 UTSW 2 118,622,361 (GRCm39) missense probably benign 0.27
R4617:Disp2 UTSW 2 118,620,643 (GRCm39) missense probably benign
R4656:Disp2 UTSW 2 118,621,044 (GRCm39) missense probably damaging 1.00
R4684:Disp2 UTSW 2 118,623,237 (GRCm39) missense probably damaging 1.00
R4696:Disp2 UTSW 2 118,622,165 (GRCm39) nonsense probably null
R4697:Disp2 UTSW 2 118,622,165 (GRCm39) nonsense probably null
R4738:Disp2 UTSW 2 118,620,807 (GRCm39) missense probably damaging 0.97
R4834:Disp2 UTSW 2 118,622,985 (GRCm39) missense probably benign 0.09
R4914:Disp2 UTSW 2 118,620,935 (GRCm39) missense probably damaging 0.99
R4915:Disp2 UTSW 2 118,620,935 (GRCm39) missense probably damaging 0.99
R4918:Disp2 UTSW 2 118,620,935 (GRCm39) missense probably damaging 0.99
R5045:Disp2 UTSW 2 118,622,543 (GRCm39) missense probably benign 0.03
R5208:Disp2 UTSW 2 118,622,286 (GRCm39) missense probably damaging 1.00
R5303:Disp2 UTSW 2 118,641,329 (GRCm39) unclassified probably benign
R5350:Disp2 UTSW 2 118,618,056 (GRCm39) missense probably benign 0.23
R5355:Disp2 UTSW 2 118,617,392 (GRCm39) missense probably benign 0.00
R6011:Disp2 UTSW 2 118,621,301 (GRCm39) missense possibly damaging 0.65
R6031:Disp2 UTSW 2 118,620,275 (GRCm39) missense probably benign 0.01
R6031:Disp2 UTSW 2 118,620,275 (GRCm39) missense probably benign 0.01
R6139:Disp2 UTSW 2 118,621,143 (GRCm39) missense probably damaging 0.97
R6169:Disp2 UTSW 2 118,622,031 (GRCm39) missense probably damaging 1.00
R6187:Disp2 UTSW 2 118,622,624 (GRCm39) missense probably damaging 1.00
R6209:Disp2 UTSW 2 118,617,402 (GRCm39) missense probably damaging 1.00
R6250:Disp2 UTSW 2 118,621,247 (GRCm39) missense probably damaging 1.00
R7138:Disp2 UTSW 2 118,617,361 (GRCm39) missense probably benign
R7156:Disp2 UTSW 2 118,622,292 (GRCm39) missense probably damaging 1.00
R7230:Disp2 UTSW 2 118,622,286 (GRCm39) missense probably damaging 1.00
R7400:Disp2 UTSW 2 118,622,367 (GRCm39) missense probably damaging 1.00
R7460:Disp2 UTSW 2 118,620,261 (GRCm39) missense probably damaging 1.00
R7505:Disp2 UTSW 2 118,621,569 (GRCm39) missense probably damaging 1.00
R7542:Disp2 UTSW 2 118,621,599 (GRCm39) missense probably damaging 0.97
R7728:Disp2 UTSW 2 118,621,961 (GRCm39) missense probably benign 0.31
R7757:Disp2 UTSW 2 118,621,391 (GRCm39) missense probably damaging 1.00
R7798:Disp2 UTSW 2 118,622,360 (GRCm39) missense probably benign
R7945:Disp2 UTSW 2 118,623,270 (GRCm39) missense probably damaging 1.00
R8013:Disp2 UTSW 2 118,620,163 (GRCm39) nonsense probably null
R8085:Disp2 UTSW 2 118,617,452 (GRCm39) missense possibly damaging 0.94
R8179:Disp2 UTSW 2 118,623,030 (GRCm39) missense probably damaging 0.99
R8288:Disp2 UTSW 2 118,620,762 (GRCm39) missense probably damaging 1.00
R8345:Disp2 UTSW 2 118,641,284 (GRCm39) missense unknown
R8385:Disp2 UTSW 2 118,620,891 (GRCm39) missense probably damaging 1.00
R8700:Disp2 UTSW 2 118,620,340 (GRCm39) nonsense probably null
R8808:Disp2 UTSW 2 118,620,489 (GRCm39) missense probably damaging 1.00
R8880:Disp2 UTSW 2 118,621,239 (GRCm39) missense probably damaging 1.00
R8997:Disp2 UTSW 2 118,617,467 (GRCm39) missense probably damaging 1.00
R9022:Disp2 UTSW 2 118,621,179 (GRCm39) missense probably benign 0.22
R9181:Disp2 UTSW 2 118,617,393 (GRCm39) missense probably benign 0.08
R9660:Disp2 UTSW 2 118,620,627 (GRCm39) missense probably benign
Z1177:Disp2 UTSW 2 118,621,308 (GRCm39) missense probably damaging 1.00
Z1177:Disp2 UTSW 2 118,620,183 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGCTGTACTAGTGCACATGG -3'
(R):5'- AACTGCTGGCGATACTCTGC -3'

Sequencing Primer
(F):5'- TACTAGTGCACATGGGGCTCAC -3'
(R):5'- CTCTGCGTCAAAGCGTTCAAAGG -3'
Posted On 2018-05-04