Mutagenetix > Incidental Mutation

Incidental Mutation 'R6392:Nup205'

515801

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

044541-MU

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R6392 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35189885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 280 (S280P)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043815
AA Change: S227P

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: S227P

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170234
AA Change: S227P

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759
AA Change: S227P

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000201374
AA Change: S280P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: S280P

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202898

Meta Mutation Damage Score

0.1532

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 96.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	T	C	6: 41,032,372	Y176C	probably damaging	Het
Aars2	A	T	17: 45,514,600	I330F	probably damaging	Het
Abcc9	A	G	6: 142,682,099	S402P	probably damaging	Het
Ada	A	G	2: 163,728,217	L292P	probably damaging	Het
Adra1d	T	C	2: 131,561,609	D187G	probably damaging	Het
AI467606	C	A	7: 127,092,545	Y97*	probably null	Het
Arid2	A	G	15: 96,361,602	E245G	probably damaging	Het
Ccdc78	C	G	17: 25,788,174	Q213E	probably damaging	Het
Cntnap1	G	T	11: 101,186,646	D1045Y	probably damaging	Het
Ctcf	T	C	8: 105,664,133	V124A	probably damaging	Het
Cutc	T	C	19: 43,760,050	S129P	possibly damaging	Het
Dhx36	T	C	3: 62,494,369	I308V	probably benign	Het
Disp2	T	C	2: 118,790,749	V654A	probably damaging	Het
Esm1	G	A	13: 113,209,749		probably benign	Het
Extl1	C	T	4: 134,364,634	V303I	probably benign	Het
Ezh1	G	T	11: 101,203,804	D387E	probably damaging	Het
Fbf1	T	A	11: 116,152,949		probably null	Het
Fbxl12	T	C	9: 20,639,176	H84R	probably damaging	Het
Fbxo6	C	T	4: 148,146,005	V267I	probably benign	Het
Gm5346	A	T	8: 43,626,001	N395K	probably benign	Het
Helz	G	T	11: 107,602,341	A197S	possibly damaging	Het
Ikbke	T	C	1: 131,275,146		probably null	Het
Kbtbd13	A	G	9: 65,390,337	F439S	possibly damaging	Het
Kif7	G	A	7: 79,702,186	R943W	probably damaging	Het
Lrp12	C	T	15: 39,872,019	C839Y	probably damaging	Het
Matr3	A	G	18: 35,584,841	D364G	probably benign	Het
Ncam1	T	C	9: 49,523,575	K624E	probably damaging	Het
Olfr1196	A	T	2: 88,700,667	Y221N	probably damaging	Het
Olfr622	A	C	7: 103,639,682	C153G	probably benign	Het
Pira2	A	T	7: 3,843,902	S214T	possibly damaging	Het
Ptpn4	T	A	1: 119,773,123	I30F	probably benign	Het
Rnf144a	T	C	12: 26,310,780	I253V	possibly damaging	Het
Sh3pxd2b	T	A	11: 32,423,302	L823Q	possibly damaging	Het
Sh3rf3	A	T	10: 59,007,076	D288V	probably damaging	Het
Shprh	T	A	10: 11,178,741	Y1031*	probably null	Het
Sidt1	T	C	16: 44,291,294	T173A	possibly damaging	Het
Smc1b	C	T	15: 85,092,031	R825Q	probably benign	Het
Ssh3	C	T	19: 4,265,371	R309H	probably benign	Het
Tagap	G	T	17: 7,934,061	G693W	probably damaging	Het
Tango2	T	A	16: 18,301,539	I143F	probably damaging	Het
Thsd7a	T	C	6: 12,468,929	H550R	probably damaging	Het
Tmem131	T	A	1: 36,881,342	Q92H	probably benign	Het
Tnfrsf21	T	C	17: 43,017,088	L31P	probably benign	Het
Ttn	A	T	2: 76,900,143		probably benign	Het
Ubash3b	T	C	9: 41,014,972	D493G	probably damaging	Het
Unc13a	C	T	8: 71,637,809	G1411D	possibly damaging	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Zfc3h1	A	T	10: 115,401,748	R477S	probably damaging	Het
Zfp87	C	T	13: 67,516,867	R492K	probably benign	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9061:Nup205	UTSW	6	35219873	intron	probably benign
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
R9648:Nup205	UTSW	6	35225811	missense	probably benign	0.00
R9744:Nup205	UTSW	6	35232575	missense	probably damaging	0.99
R9800:Nup205	UTSW	6	35186533	missense	possibly damaging	0.85
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CAAGCAATTGGTCAGCGTGG -3'
(R):5'- TCCTCTGTGCTTTGGTCTATAAAG -3'

Sequencing Primer
(F):5'- GCGTGGTTTCTCAAGGACTAAACC -3'
(R):5'- GGTCTATAAAGCTGGTATCAAAACAG -3'

Posted On

2018-05-04