Incidental Mutation 'R6392:Ubash3b'
ID515812
Institutional Source Beutler Lab
Gene Symbol Ubash3b
Ensembl Gene ENSMUSG00000032020
Gene Nameubiquitin associated and SH3 domain containing, B
Synonyms2810457I06Rik, TULA-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6392 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location41011098-41161697 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41014972 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 493 (D493G)
Ref Sequence ENSEMBL: ENSMUSP00000116038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044155] [ENSMUST00000151485]
Predicted Effect probably damaging
Transcript: ENSMUST00000044155
AA Change: D615G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043865
Gene: ENSMUSG00000032020
AA Change: D615G

DomainStartEndE-ValueType
UBA 26 64 2.43e-4 SMART
low complexity region 177 186 N/A INTRINSIC
SH3 246 307 7.29e-10 SMART
Pfam:His_Phos_1 415 598 3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151485
AA Change: D493G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116038
Gene: ENSMUSG00000032020
AA Change: D493G

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
SH3 124 185 7.29e-10 SMART
Pfam:His_Phos_1 252 450 1.9e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. The encoded protein was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, developmentally normal, and do not display any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T C 6: 41,032,372 Y176C probably damaging Het
Aars2 A T 17: 45,514,600 I330F probably damaging Het
Abcc9 A G 6: 142,682,099 S402P probably damaging Het
Ada A G 2: 163,728,217 L292P probably damaging Het
Adra1d T C 2: 131,561,609 D187G probably damaging Het
AI467606 C A 7: 127,092,545 Y97* probably null Het
Arid2 A G 15: 96,361,602 E245G probably damaging Het
Ccdc78 C G 17: 25,788,174 Q213E probably damaging Het
Cntnap1 G T 11: 101,186,646 D1045Y probably damaging Het
Ctcf T C 8: 105,664,133 V124A probably damaging Het
Cutc T C 19: 43,760,050 S129P possibly damaging Het
Dhx36 T C 3: 62,494,369 I308V probably benign Het
Disp2 T C 2: 118,790,749 V654A probably damaging Het
Esm1 G A 13: 113,209,749 probably benign Het
Extl1 C T 4: 134,364,634 V303I probably benign Het
Ezh1 G T 11: 101,203,804 D387E probably damaging Het
Fbf1 T A 11: 116,152,949 probably null Het
Fbxl12 T C 9: 20,639,176 H84R probably damaging Het
Fbxo6 C T 4: 148,146,005 V267I probably benign Het
Gm5346 A T 8: 43,626,001 N395K probably benign Het
Helz G T 11: 107,602,341 A197S possibly damaging Het
Ikbke T C 1: 131,275,146 probably null Het
Kbtbd13 A G 9: 65,390,337 F439S possibly damaging Het
Kif7 G A 7: 79,702,186 R943W probably damaging Het
Lrp12 C T 15: 39,872,019 C839Y probably damaging Het
Matr3 A G 18: 35,584,841 D364G probably benign Het
Ncam1 T C 9: 49,523,575 K624E probably damaging Het
Nup205 T C 6: 35,189,885 S280P possibly damaging Het
Olfr1196 A T 2: 88,700,667 Y221N probably damaging Het
Olfr622 A C 7: 103,639,682 C153G probably benign Het
Pira2 A T 7: 3,843,902 S214T possibly damaging Het
Ptpn4 T A 1: 119,773,123 I30F probably benign Het
Rnf144a T C 12: 26,310,780 I253V possibly damaging Het
Sh3pxd2b T A 11: 32,423,302 L823Q possibly damaging Het
Sh3rf3 A T 10: 59,007,076 D288V probably damaging Het
Shprh T A 10: 11,178,741 Y1031* probably null Het
Sidt1 T C 16: 44,291,294 T173A possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Ssh3 C T 19: 4,265,371 R309H probably benign Het
Tagap G T 17: 7,934,061 G693W probably damaging Het
Tango2 T A 16: 18,301,539 I143F probably damaging Het
Thsd7a T C 6: 12,468,929 H550R probably damaging Het
Tmem131 T A 1: 36,881,342 Q92H probably benign Het
Tnfrsf21 T C 17: 43,017,088 L31P probably benign Het
Ttn A T 2: 76,900,143 probably benign Het
Unc13a C T 8: 71,637,809 G1411D possibly damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfc3h1 A T 10: 115,401,748 R477S probably damaging Het
Zfp87 C T 13: 67,516,867 R492K probably benign Het
Other mutations in Ubash3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ubash3b APN 9 41018015 critical splice donor site probably null
IGL01734:Ubash3b APN 9 41026247 splice site probably benign
IGL02311:Ubash3b APN 9 41047037 missense probably benign
IGL03406:Ubash3b APN 9 41037479 missense probably damaging 1.00
PIT4618001:Ubash3b UTSW 9 41016627 missense probably benign 0.00
PIT4687001:Ubash3b UTSW 9 41023518 missense probably damaging 1.00
R0524:Ubash3b UTSW 9 41016608 missense probably benign 0.16
R0666:Ubash3b UTSW 9 41047064 missense possibly damaging 0.67
R0927:Ubash3b UTSW 9 41023557 nonsense probably null
R1112:Ubash3b UTSW 9 41028116 missense probably damaging 1.00
R1544:Ubash3b UTSW 9 41016605 missense probably damaging 1.00
R1596:Ubash3b UTSW 9 41031497 missense probably benign
R1610:Ubash3b UTSW 9 41043500 missense probably damaging 1.00
R2069:Ubash3b UTSW 9 41043573 missense possibly damaging 0.82
R2507:Ubash3b UTSW 9 41157354 missense possibly damaging 0.90
R2520:Ubash3b UTSW 9 41014947 missense probably damaging 1.00
R3899:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R3900:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R4715:Ubash3b UTSW 9 41016600 missense probably damaging 1.00
R4876:Ubash3b UTSW 9 41018109 missense probably benign 0.00
R5023:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5034:Ubash3b UTSW 9 41029740 missense probably benign 0.25
R5057:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5396:Ubash3b UTSW 9 41043473 critical splice donor site probably null
R5448:Ubash3b UTSW 9 41037435 critical splice donor site probably null
R5760:Ubash3b UTSW 9 41077423 missense probably benign 0.00
R6178:Ubash3b UTSW 9 41014916 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCTGCTTTGAATGCAGCG -3'
(R):5'- GCTTAGCCTGACAGGTTCTATC -3'

Sequencing Primer
(F):5'- CTTTGAATGCAGCGTGGGC -3'
(R):5'- AGCCTGACAGGTTCTATCTGTTTG -3'
Posted On2018-05-04