Incidental Mutation 'R6392:Ncam1'
ID515813
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R6392 (G1)
Quality Score191.009
Status Validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49523575 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 624 (K624E)
Ref Sequence ENSEMBL: ENSMUSP00000142275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000193547]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068730
Predicted Effect probably damaging
Transcript: ENSMUST00000114476
AA Change: K624E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542
AA Change: K624E

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
low complexity region 711 725 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166811
AA Change: K624E
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542
AA Change: K624E

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193547
AA Change: K624E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542
AA Change: K624E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194252
AA Change: K597E
Predicted Effect probably benign
Transcript: ENSMUST00000194844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216483
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T C 6: 41,032,372 Y176C probably damaging Het
Aars2 A T 17: 45,514,600 I330F probably damaging Het
Abcc9 A G 6: 142,682,099 S402P probably damaging Het
Ada A G 2: 163,728,217 L292P probably damaging Het
Adra1d T C 2: 131,561,609 D187G probably damaging Het
AI467606 C A 7: 127,092,545 Y97* probably null Het
Arid2 A G 15: 96,361,602 E245G probably damaging Het
Ccdc78 C G 17: 25,788,174 Q213E probably damaging Het
Cntnap1 G T 11: 101,186,646 D1045Y probably damaging Het
Ctcf T C 8: 105,664,133 V124A probably damaging Het
Cutc T C 19: 43,760,050 S129P possibly damaging Het
Dhx36 T C 3: 62,494,369 I308V probably benign Het
Disp2 T C 2: 118,790,749 V654A probably damaging Het
Esm1 G A 13: 113,209,749 probably benign Het
Extl1 C T 4: 134,364,634 V303I probably benign Het
Ezh1 G T 11: 101,203,804 D387E probably damaging Het
Fbf1 T A 11: 116,152,949 probably null Het
Fbxl12 T C 9: 20,639,176 H84R probably damaging Het
Fbxo6 C T 4: 148,146,005 V267I probably benign Het
Gm5346 A T 8: 43,626,001 N395K probably benign Het
Helz G T 11: 107,602,341 A197S possibly damaging Het
Ikbke T C 1: 131,275,146 probably null Het
Kbtbd13 A G 9: 65,390,337 F439S possibly damaging Het
Kif7 G A 7: 79,702,186 R943W probably damaging Het
Lrp12 C T 15: 39,872,019 C839Y probably damaging Het
Matr3 A G 18: 35,584,841 D364G probably benign Het
Nup205 T C 6: 35,189,885 S280P possibly damaging Het
Olfr1196 A T 2: 88,700,667 Y221N probably damaging Het
Olfr622 A C 7: 103,639,682 C153G probably benign Het
Pira2 A T 7: 3,843,902 S214T possibly damaging Het
Ptpn4 T A 1: 119,773,123 I30F probably benign Het
Rnf144a T C 12: 26,310,780 I253V possibly damaging Het
Sh3pxd2b T A 11: 32,423,302 L823Q possibly damaging Het
Sh3rf3 A T 10: 59,007,076 D288V probably damaging Het
Shprh T A 10: 11,178,741 Y1031* probably null Het
Sidt1 T C 16: 44,291,294 T173A possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Ssh3 C T 19: 4,265,371 R309H probably benign Het
Tagap G T 17: 7,934,061 G693W probably damaging Het
Tango2 T A 16: 18,301,539 I143F probably damaging Het
Thsd7a T C 6: 12,468,929 H550R probably damaging Het
Tmem131 T A 1: 36,881,342 Q92H probably benign Het
Tnfrsf21 T C 17: 43,017,088 L31P probably benign Het
Ttn A T 2: 76,900,143 probably benign Het
Ubash3b T C 9: 41,014,972 D493G probably damaging Het
Unc13a C T 8: 71,637,809 G1411D possibly damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfc3h1 A T 10: 115,401,748 R477S probably damaging Het
Zfp87 C T 13: 67,516,867 R492K probably benign Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
R7561:Ncam1 UTSW 9 49564942 missense probably damaging 1.00
R7645:Ncam1 UTSW 9 49565003 missense probably benign 0.01
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTAGGTATCAGGGTCCC -3'
(R):5'- TTGAATCTCTGGAAAAGCAAGC -3'

Sequencing Primer
(F):5'- AGGTATCAGGGTCCCAGGTTC -3'
(R):5'- TCTCTGGAAAAGCAAGCAAAGTGC -3'
Posted On2018-05-04