Incidental Mutation 'R6392:Shprh'
ID 515815
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 044541-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6392 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 11054485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1031 (Y1031*)
Ref Sequence ENSEMBL: ENSMUSP00000132870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably null
Transcript: ENSMUST00000044053
AA Change: Y1031*
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: Y1031*

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054814
AA Change: Y1031*
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: Y1031*

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000159541
AA Change: Y1031*
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: Y1031*

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159553
Predicted Effect probably benign
Transcript: ENSMUST00000159810
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,825,526 (GRCm39) I330F probably damaging Het
Abcc9 A G 6: 142,627,825 (GRCm39) S402P probably damaging Het
Ada A G 2: 163,570,137 (GRCm39) L292P probably damaging Het
Adam34l A T 8: 44,079,038 (GRCm39) N395K probably benign Het
Adra1d T C 2: 131,403,529 (GRCm39) D187G probably damaging Het
AI467606 C A 7: 126,691,717 (GRCm39) Y97* probably null Het
Arid2 A G 15: 96,259,483 (GRCm39) E245G probably damaging Het
Ccdc78 C G 17: 26,007,148 (GRCm39) Q213E probably damaging Het
Cntnap1 G T 11: 101,077,472 (GRCm39) D1045Y probably damaging Het
Ctcf T C 8: 106,390,765 (GRCm39) V124A probably damaging Het
Cutc T C 19: 43,748,489 (GRCm39) S129P possibly damaging Het
Dhx36 T C 3: 62,401,790 (GRCm39) I308V probably benign Het
Disp2 T C 2: 118,621,230 (GRCm39) V654A probably damaging Het
Esm1 G A 13: 113,346,283 (GRCm39) probably benign Het
Extl1 C T 4: 134,091,945 (GRCm39) V303I probably benign Het
Ezh1 G T 11: 101,094,630 (GRCm39) D387E probably damaging Het
Fbf1 T A 11: 116,043,775 (GRCm39) probably null Het
Fbxl12 T C 9: 20,550,472 (GRCm39) H84R probably damaging Het
Fbxo6 C T 4: 148,230,462 (GRCm39) V267I probably benign Het
Helz G T 11: 107,493,167 (GRCm39) A197S possibly damaging Het
Ikbke T C 1: 131,202,883 (GRCm39) probably null Het
Kbtbd13 A G 9: 65,297,619 (GRCm39) F439S possibly damaging Het
Kif7 G A 7: 79,351,934 (GRCm39) R943W probably damaging Het
Lrp12 C T 15: 39,735,415 (GRCm39) C839Y probably damaging Het
Matr3 A G 18: 35,717,894 (GRCm39) D364G probably benign Het
Ncam1 T C 9: 49,434,875 (GRCm39) K624E probably damaging Het
Nup205 T C 6: 35,166,820 (GRCm39) S280P possibly damaging Het
Or4a66 A T 2: 88,531,011 (GRCm39) Y221N probably damaging Het
Or52a33 A C 7: 103,288,889 (GRCm39) C153G probably benign Het
Pira2 A T 7: 3,846,901 (GRCm39) S214T possibly damaging Het
Prss3b T C 6: 41,009,306 (GRCm39) Y176C probably damaging Het
Ptpn4 T A 1: 119,700,853 (GRCm39) I30F probably benign Het
Rnf144a T C 12: 26,360,779 (GRCm39) I253V possibly damaging Het
Sh3pxd2b T A 11: 32,373,302 (GRCm39) L823Q possibly damaging Het
Sh3rf3 A T 10: 58,842,898 (GRCm39) D288V probably damaging Het
Sidt1 T C 16: 44,111,657 (GRCm39) T173A possibly damaging Het
Smc1b C T 15: 84,976,232 (GRCm39) R825Q probably benign Het
Ssh3 C T 19: 4,315,399 (GRCm39) R309H probably benign Het
Tagap G T 17: 8,152,893 (GRCm39) G693W probably damaging Het
Tango2 T A 16: 18,119,403 (GRCm39) I143F probably damaging Het
Thsd7a T C 6: 12,468,928 (GRCm39) H550R probably damaging Het
Tmem131 T A 1: 36,920,423 (GRCm39) Q92H probably benign Het
Tnfrsf21 T C 17: 43,327,979 (GRCm39) L31P probably benign Het
Ttn A T 2: 76,730,487 (GRCm39) probably benign Het
Ubash3b T C 9: 40,926,268 (GRCm39) D493G probably damaging Het
Unc13a C T 8: 72,090,453 (GRCm39) G1411D possibly damaging Het
Vmn2r106 C T 17: 20,488,725 (GRCm39) C558Y probably damaging Het
Zfc3h1 A T 10: 115,237,653 (GRCm39) R477S probably damaging Het
Zfp87 C T 13: 67,664,986 (GRCm39) R492K probably benign Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0494:Shprh UTSW 10 11,032,935 (GRCm39) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,062,591 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,032,822 (GRCm39) missense probably benign
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5450:Shprh UTSW 10 11,088,074 (GRCm39) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7812:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,038,574 (GRCm39) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,089,248 (GRCm39) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGTATCTGAGAGTATTACCGTGGTG -3'
(R):5'- AGGAATGCCTGCTTTTACCTC -3'

Sequencing Primer
(F):5'- CCGTGGTGGTGAGGCTG -3'
(R):5'- GTATTCTGACTCAGTTCATTGTAACC -3'
Posted On 2018-05-04