Incidental Mutation 'R6392:Fbf1'
ID515822
Institutional Source Beutler Lab
Gene Symbol Fbf1
Ensembl Gene ENSMUSG00000020776
Gene NameFas (TNFRSF6) binding factor 1
Synonyms1110033G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6392 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116142285-116168166 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 116152949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103031] [ENSMUST00000103031] [ENSMUST00000103031] [ENSMUST00000106435] [ENSMUST00000106435] [ENSMUST00000106435] [ENSMUST00000124828]
Predicted Effect probably null
Transcript: ENSMUST00000103031
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103031
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103031
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106435
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106435
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106435
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124828
SMART Domains Protein: ENSMUSP00000114558
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150703
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T C 6: 41,032,372 Y176C probably damaging Het
Aars2 A T 17: 45,514,600 I330F probably damaging Het
Abcc9 A G 6: 142,682,099 S402P probably damaging Het
Ada A G 2: 163,728,217 L292P probably damaging Het
Adra1d T C 2: 131,561,609 D187G probably damaging Het
AI467606 C A 7: 127,092,545 Y97* probably null Het
Arid2 A G 15: 96,361,602 E245G probably damaging Het
Ccdc78 C G 17: 25,788,174 Q213E probably damaging Het
Cntnap1 G T 11: 101,186,646 D1045Y probably damaging Het
Ctcf T C 8: 105,664,133 V124A probably damaging Het
Cutc T C 19: 43,760,050 S129P possibly damaging Het
Dhx36 T C 3: 62,494,369 I308V probably benign Het
Disp2 T C 2: 118,790,749 V654A probably damaging Het
Esm1 G A 13: 113,209,749 probably benign Het
Extl1 C T 4: 134,364,634 V303I probably benign Het
Ezh1 G T 11: 101,203,804 D387E probably damaging Het
Fbxl12 T C 9: 20,639,176 H84R probably damaging Het
Fbxo6 C T 4: 148,146,005 V267I probably benign Het
Gm5346 A T 8: 43,626,001 N395K probably benign Het
Helz G T 11: 107,602,341 A197S possibly damaging Het
Ikbke T C 1: 131,275,146 probably null Het
Kbtbd13 A G 9: 65,390,337 F439S possibly damaging Het
Kif7 G A 7: 79,702,186 R943W probably damaging Het
Lrp12 C T 15: 39,872,019 C839Y probably damaging Het
Matr3 A G 18: 35,584,841 D364G probably benign Het
Ncam1 T C 9: 49,523,575 K624E probably damaging Het
Nup205 T C 6: 35,189,885 S280P possibly damaging Het
Olfr1196 A T 2: 88,700,667 Y221N probably damaging Het
Olfr622 A C 7: 103,639,682 C153G probably benign Het
Pira2 A T 7: 3,843,902 S214T possibly damaging Het
Ptpn4 T A 1: 119,773,123 I30F probably benign Het
Rnf144a T C 12: 26,310,780 I253V possibly damaging Het
Sh3pxd2b T A 11: 32,423,302 L823Q possibly damaging Het
Sh3rf3 A T 10: 59,007,076 D288V probably damaging Het
Shprh T A 10: 11,178,741 Y1031* probably null Het
Sidt1 T C 16: 44,291,294 T173A possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Ssh3 C T 19: 4,265,371 R309H probably benign Het
Tagap G T 17: 7,934,061 G693W probably damaging Het
Tango2 T A 16: 18,301,539 I143F probably damaging Het
Thsd7a T C 6: 12,468,929 H550R probably damaging Het
Tmem131 T A 1: 36,881,342 Q92H probably benign Het
Tnfrsf21 T C 17: 43,017,088 L31P probably benign Het
Ttn A T 2: 76,900,143 probably benign Het
Ubash3b T C 9: 41,014,972 D493G probably damaging Het
Unc13a C T 8: 71,637,809 G1411D possibly damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfc3h1 A T 10: 115,401,748 R477S probably damaging Het
Zfp87 C T 13: 67,516,867 R492K probably benign Het
Other mutations in Fbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Fbf1 APN 11 116151081 missense probably benign 0.00
IGL01420:Fbf1 APN 11 116145996 missense probably benign 0.07
IGL01971:Fbf1 APN 11 116143382 unclassified probably benign
IGL01995:Fbf1 APN 11 116151020 missense probably null 0.00
IGL02639:Fbf1 APN 11 116152600 missense probably benign 0.14
IGL02884:Fbf1 APN 11 116146513 missense probably damaging 1.00
IGL03001:Fbf1 APN 11 116165886 start gained probably benign
IGL03309:Fbf1 APN 11 116147811 missense probably damaging 1.00
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0257:Fbf1 UTSW 11 116155091 missense probably benign 0.05
R0394:Fbf1 UTSW 11 116152462 unclassified probably benign
R0637:Fbf1 UTSW 11 116160054 unclassified probably benign
R1512:Fbf1 UTSW 11 116147927 missense probably damaging 1.00
R1679:Fbf1 UTSW 11 116151017 critical splice donor site probably null
R1726:Fbf1 UTSW 11 116145454 missense probably benign
R1909:Fbf1 UTSW 11 116145992 missense possibly damaging 0.79
R1970:Fbf1 UTSW 11 116151491 missense possibly damaging 0.93
R2507:Fbf1 UTSW 11 116155426 missense probably benign
R2847:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2849:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2867:Fbf1 UTSW 11 116161448 unclassified probably benign
R3161:Fbf1 UTSW 11 116148220 missense probably damaging 1.00
R3711:Fbf1 UTSW 11 116161473 missense possibly damaging 0.66
R3711:Fbf1 UTSW 11 116163353 missense probably damaging 1.00
R3752:Fbf1 UTSW 11 116147796 missense probably benign 0.21
R4293:Fbf1 UTSW 11 116148894 missense probably damaging 1.00
R4344:Fbf1 UTSW 11 116147742 missense probably benign
R4345:Fbf1 UTSW 11 116147742 missense probably benign
R4604:Fbf1 UTSW 11 116158922 missense possibly damaging 0.81
R4828:Fbf1 UTSW 11 116148951 missense probably benign 0.00
R4936:Fbf1 UTSW 11 116152552 missense probably benign 0.05
R5561:Fbf1 UTSW 11 116157820 missense probably damaging 1.00
R6559:Fbf1 UTSW 11 116155446 missense probably benign 0.15
R6993:Fbf1 UTSW 11 116152784 missense probably benign
R7207:Fbf1 UTSW 11 116149474 missense probably benign 0.01
R7544:Fbf1 UTSW 11 116165833 missense probably benign 0.01
R7988:Fbf1 UTSW 11 116152768 missense probably benign 0.00
R8230:Fbf1 UTSW 11 116146739 missense probably benign
R8262:Fbf1 UTSW 11 116154019 missense probably benign 0.19
R8508:Fbf1 UTSW 11 116165881 start codon destroyed probably null 0.00
X0020:Fbf1 UTSW 11 116150793 missense possibly damaging 0.78
X0060:Fbf1 UTSW 11 116148856 nonsense probably null
X0062:Fbf1 UTSW 11 116149426 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCTGTTGGGCCTTTTGAAC -3'
(R):5'- AGCGTCAGTGCTGTTATTCC -3'

Sequencing Primer
(F):5'- TGGGCCTTTTGAACAGGAGAG -3'
(R):5'- GGCTAGCCTTGAACTTACAGCAG -3'
Posted On2018-05-04