Incidental Mutation 'R6392:Zfp87'
ID515824
Institutional Source Beutler Lab
Gene Symbol Zfp87
Ensembl Gene ENSMUSG00000097333
Gene Namezinc finger protein 87
SynonymsMzf22, 2210039O17Rik, Zfp72, KRAB4, 4631412O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6392 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67515781-67526177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67516867 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 492 (R492K)
Ref Sequence ENSEMBL: ENSMUSP00000138087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167914] [ENSMUST00000180536] [ENSMUST00000181341] [ENSMUST00000181573] [ENSMUST00000181767]
Predicted Effect probably benign
Transcript: ENSMUST00000167914
SMART Domains Protein: ENSMUSP00000137830
Gene: ENSMUSG00000097565

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180536
SMART Domains Protein: ENSMUSP00000137812
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 51 7.02e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181341
SMART Domains Protein: ENSMUSP00000137689
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181573
SMART Domains Protein: ENSMUSP00000138011
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 51 7.02e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181767
AA Change: R492K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000138087
Gene: ENSMUSG00000097333
AA Change: R492K

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
ZnF_C2H2 109 131 2.61e-4 SMART
ZnF_C2H2 137 159 9.22e-5 SMART
ZnF_C2H2 165 187 2.36e-2 SMART
ZnF_C2H2 193 215 7.15e-2 SMART
ZnF_C2H2 221 243 9.22e-5 SMART
ZnF_C2H2 249 271 3.63e-3 SMART
ZnF_C2H2 277 299 6.42e-4 SMART
ZnF_C2H2 305 327 2.99e-4 SMART
ZnF_C2H2 333 355 2.4e-3 SMART
ZnF_C2H2 361 383 5.59e-4 SMART
ZnF_C2H2 389 411 3.69e-4 SMART
ZnF_C2H2 417 439 5.9e-3 SMART
ZnF_C2H2 445 467 3.21e-4 SMART
ZnF_C2H2 472 494 9.08e-4 SMART
ZnF_C2H2 500 522 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T C 6: 41,032,372 Y176C probably damaging Het
Aars2 A T 17: 45,514,600 I330F probably damaging Het
Abcc9 A G 6: 142,682,099 S402P probably damaging Het
Ada A G 2: 163,728,217 L292P probably damaging Het
Adra1d T C 2: 131,561,609 D187G probably damaging Het
AI467606 C A 7: 127,092,545 Y97* probably null Het
Arid2 A G 15: 96,361,602 E245G probably damaging Het
Ccdc78 C G 17: 25,788,174 Q213E probably damaging Het
Cntnap1 G T 11: 101,186,646 D1045Y probably damaging Het
Ctcf T C 8: 105,664,133 V124A probably damaging Het
Cutc T C 19: 43,760,050 S129P possibly damaging Het
Dhx36 T C 3: 62,494,369 I308V probably benign Het
Disp2 T C 2: 118,790,749 V654A probably damaging Het
Esm1 G A 13: 113,209,749 probably benign Het
Extl1 C T 4: 134,364,634 V303I probably benign Het
Ezh1 G T 11: 101,203,804 D387E probably damaging Het
Fbf1 T A 11: 116,152,949 probably null Het
Fbxl12 T C 9: 20,639,176 H84R probably damaging Het
Fbxo6 C T 4: 148,146,005 V267I probably benign Het
Gm5346 A T 8: 43,626,001 N395K probably benign Het
Helz G T 11: 107,602,341 A197S possibly damaging Het
Ikbke T C 1: 131,275,146 probably null Het
Kbtbd13 A G 9: 65,390,337 F439S possibly damaging Het
Kif7 G A 7: 79,702,186 R943W probably damaging Het
Lrp12 C T 15: 39,872,019 C839Y probably damaging Het
Matr3 A G 18: 35,584,841 D364G probably benign Het
Ncam1 T C 9: 49,523,575 K624E probably damaging Het
Nup205 T C 6: 35,189,885 S280P possibly damaging Het
Olfr1196 A T 2: 88,700,667 Y221N probably damaging Het
Olfr622 A C 7: 103,639,682 C153G probably benign Het
Pira2 A T 7: 3,843,902 S214T possibly damaging Het
Ptpn4 T A 1: 119,773,123 I30F probably benign Het
Rnf144a T C 12: 26,310,780 I253V possibly damaging Het
Sh3pxd2b T A 11: 32,423,302 L823Q possibly damaging Het
Sh3rf3 A T 10: 59,007,076 D288V probably damaging Het
Shprh T A 10: 11,178,741 Y1031* probably null Het
Sidt1 T C 16: 44,291,294 T173A possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Ssh3 C T 19: 4,265,371 R309H probably benign Het
Tagap G T 17: 7,934,061 G693W probably damaging Het
Tango2 T A 16: 18,301,539 I143F probably damaging Het
Thsd7a T C 6: 12,468,929 H550R probably damaging Het
Tmem131 T A 1: 36,881,342 Q92H probably benign Het
Tnfrsf21 T C 17: 43,017,088 L31P probably benign Het
Ttn A T 2: 76,900,143 probably benign Het
Ubash3b T C 9: 41,014,972 D493G probably damaging Het
Unc13a C T 8: 71,637,809 G1411D possibly damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfc3h1 A T 10: 115,401,748 R477S probably damaging Het
Other mutations in Zfp87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Zfp87 APN 13 67517870 missense probably damaging 0.99
IGL02372:Zfp87 APN 13 67520620 splice site probably benign
IGL03160:Zfp87 APN 13 67521273 missense probably damaging 1.00
R3801:Zfp87 UTSW 13 67521215 missense probably damaging 1.00
R4950:Zfp87 UTSW 13 67517899 missense probably benign 0.20
R5604:Zfp87 UTSW 13 67517826 missense probably damaging 1.00
R7009:Zfp87 UTSW 13 67517054 missense probably damaging 1.00
R7183:Zfp87 UTSW 13 67517474 missense probably damaging 1.00
R7448:Zfp87 UTSW 13 67517044 missense probably benign 0.01
R7597:Zfp87 UTSW 13 67517293 missense probably benign 0.06
Z1176:Zfp87 UTSW 13 67526156 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TACCTTGTATCTAACGAAGCCC -3'
(R):5'- GCATAGACTTGGTCACTCTGGAG -3'

Sequencing Primer
(F):5'- CGCCAATGTGAATTTCCTGATG -3'
(R):5'- CTTGGTCACTCTGGAGAGAAGC -3'
Posted On2018-05-04